Incidental Mutation 'R3971:Atp10b'
ID 310979
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene Name ATPase, class V, type 10B
Synonyms 9030605H24Rik, 5930426O13Rik
MMRRC Submission 040839-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R3971 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 43040704-43153112 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43107339 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 791 (D791G)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
AlphaFold B1AWN4
Predicted Effect probably damaging
Transcript: ENSMUST00000077659
AA Change: D791G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: D791G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127604
Meta Mutation Damage Score 0.6953 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat C T 8: 60,971,615 (GRCm39) P147L probably damaging Het
Apbb1ip T A 2: 22,713,506 (GRCm39) D120E unknown Het
Aunip A G 4: 134,250,780 (GRCm39) K242E possibly damaging Het
Ccdc80 A G 16: 44,916,183 (GRCm39) E313G probably benign Het
Cd72 C T 4: 43,449,491 (GRCm39) R275H probably damaging Het
Chrnb1 A G 11: 69,683,742 (GRCm39) probably benign Het
Coro2b C T 9: 62,336,522 (GRCm39) A251T possibly damaging Het
Cspg4b A G 13: 113,453,660 (GRCm39) E41G probably damaging Het
Ddr2 A G 1: 169,815,986 (GRCm39) F574L probably damaging Het
Dock1 G A 7: 134,348,637 (GRCm39) D284N probably damaging Het
Dync1h1 A G 12: 110,632,399 (GRCm39) H4506R probably benign Het
Fam174b T C 7: 73,416,348 (GRCm39) V147A probably damaging Het
Glp2r T A 11: 67,637,641 (GRCm39) D130V possibly damaging Het
Gm18856 A T 13: 14,139,433 (GRCm39) probably benign Het
Gm7247 A G 14: 51,602,841 (GRCm39) Y59C probably damaging Het
Hecw1 T C 13: 14,411,514 (GRCm39) D1062G probably damaging Het
Ifit2 A G 19: 34,551,441 (GRCm39) E327G probably benign Het
Ighv1-37 A T 12: 114,860,079 (GRCm39) S43T probably damaging Het
Man2b1 A G 8: 85,812,020 (GRCm39) N158S probably damaging Het
Mcoln1 T A 8: 3,557,408 (GRCm39) I138K probably benign Het
Mki67 A C 7: 135,297,859 (GRCm39) S2392A probably benign Het
Mrc2 G A 11: 105,218,857 (GRCm39) D193N possibly damaging Het
Myo5b C T 18: 74,873,598 (GRCm39) L1501F probably damaging Het
Nckap1l A G 15: 103,370,987 (GRCm39) K189E probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or6c69 T C 10: 129,747,742 (GRCm39) N135S probably benign Het
Otop1 A G 5: 38,457,533 (GRCm39) I431V probably benign Het
Psma8 A G 18: 14,890,444 (GRCm39) K195E possibly damaging Het
Rbm25 A G 12: 83,721,982 (GRCm39) T723A probably benign Het
Sema3b A G 9: 107,477,567 (GRCm39) S485P probably benign Het
Slc12a2 T A 18: 58,063,268 (GRCm39) L916Q possibly damaging Het
Spata31d1a T A 13: 59,849,971 (GRCm39) D719V possibly damaging Het
Synj1 A G 16: 90,788,491 (GRCm39) S86P probably damaging Het
Tmem130 T A 5: 144,692,131 (GRCm39) H91L probably benign Het
Tsc2 T C 17: 24,842,562 (GRCm39) D288G probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vps35l T C 7: 118,433,022 (GRCm39) I585T probably damaging Het
Wac T C 18: 7,916,175 (GRCm39) V303A probably damaging Het
Zfhx2 A G 14: 55,311,932 (GRCm39) V254A probably benign Het
Zfp993 A G 4: 146,742,089 (GRCm39) T138A probably benign Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43,092,988 (GRCm39) missense probably damaging 1.00
IGL01385:Atp10b APN 11 43,125,256 (GRCm39) missense probably damaging 1.00
IGL01524:Atp10b APN 11 43,150,672 (GRCm39) missense probably benign 0.18
IGL01575:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01588:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01590:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01832:Atp10b APN 11 43,125,262 (GRCm39) missense probably damaging 0.98
IGL01927:Atp10b APN 11 43,150,231 (GRCm39) splice site probably benign
IGL01933:Atp10b APN 11 43,085,457 (GRCm39) missense probably damaging 1.00
IGL02182:Atp10b APN 11 43,139,774 (GRCm39) missense probably damaging 1.00
IGL02215:Atp10b APN 11 43,085,492 (GRCm39) critical splice donor site probably null
IGL02216:Atp10b APN 11 43,150,616 (GRCm39) missense probably damaging 0.98
IGL02973:Atp10b APN 11 43,088,336 (GRCm39) missense probably damaging 1.00
IGL03012:Atp10b APN 11 43,085,482 (GRCm39) missense probably damaging 0.99
IGL03106:Atp10b APN 11 43,138,304 (GRCm39) missense probably benign 0.32
IGL03123:Atp10b APN 11 43,044,110 (GRCm39) missense probably benign 0.01
IGL03202:Atp10b APN 11 43,125,268 (GRCm39) critical splice donor site probably null
IGL03339:Atp10b APN 11 43,121,442 (GRCm39) missense probably null 0.71
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0281:Atp10b UTSW 11 43,044,131 (GRCm39) missense probably benign 0.00
R0379:Atp10b UTSW 11 43,145,141 (GRCm39) missense probably benign 0.05
R0380:Atp10b UTSW 11 43,116,424 (GRCm39) missense probably damaging 1.00
R0470:Atp10b UTSW 11 43,093,866 (GRCm39) missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1368:Atp10b UTSW 11 43,092,981 (GRCm39) missense probably damaging 1.00
R1370:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1413:Atp10b UTSW 11 43,121,391 (GRCm39) missense probably benign 0.00
R1502:Atp10b UTSW 11 43,121,174 (GRCm39) missense probably damaging 1.00
R1530:Atp10b UTSW 11 43,088,351 (GRCm39) missense probably benign 0.03
R1596:Atp10b UTSW 11 43,126,594 (GRCm39) missense probably damaging 1.00
R1675:Atp10b UTSW 11 43,116,475 (GRCm39) missense probably damaging 1.00
R1880:Atp10b UTSW 11 43,150,259 (GRCm39) missense probably damaging 1.00
R1938:Atp10b UTSW 11 43,121,245 (GRCm39) missense probably benign 0.00
R1986:Atp10b UTSW 11 43,063,595 (GRCm39) missense probably benign 0.12
R2081:Atp10b UTSW 11 43,092,955 (GRCm39) missense probably damaging 1.00
R2083:Atp10b UTSW 11 43,103,250 (GRCm39) missense probably benign 0.24
R2159:Atp10b UTSW 11 43,042,680 (GRCm39) missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43,125,207 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,080,440 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,063,572 (GRCm39) missense probably damaging 1.00
R3741:Atp10b UTSW 11 43,126,489 (GRCm39) missense probably damaging 1.00
R3942:Atp10b UTSW 11 43,063,581 (GRCm39) missense probably damaging 1.00
R4007:Atp10b UTSW 11 43,150,679 (GRCm39) missense probably benign 0.04
R4050:Atp10b UTSW 11 43,150,363 (GRCm39) missense probably benign 0.00
R4078:Atp10b UTSW 11 43,044,110 (GRCm39) missense probably benign 0.01
R4567:Atp10b UTSW 11 43,088,384 (GRCm39) missense probably benign 0.03
R4651:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4652:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4667:Atp10b UTSW 11 43,138,345 (GRCm39) missense probably damaging 1.00
R4720:Atp10b UTSW 11 43,093,949 (GRCm39) missense probably benign
R4987:Atp10b UTSW 11 43,042,440 (GRCm39) utr 5 prime probably benign
R5232:Atp10b UTSW 11 43,093,006 (GRCm39) missense probably damaging 1.00
R5233:Atp10b UTSW 11 43,121,387 (GRCm39) missense probably benign 0.06
R5281:Atp10b UTSW 11 43,145,163 (GRCm39) missense probably damaging 0.97
R5307:Atp10b UTSW 11 43,103,302 (GRCm39) missense probably damaging 1.00
R5460:Atp10b UTSW 11 43,121,282 (GRCm39) missense probably benign 0.00
R5518:Atp10b UTSW 11 43,042,463 (GRCm39) missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43,136,252 (GRCm39) missense probably damaging 1.00
R5688:Atp10b UTSW 11 43,092,000 (GRCm39) missense probably benign 0.00
R5735:Atp10b UTSW 11 43,042,601 (GRCm39) missense probably benign 0.00
R6153:Atp10b UTSW 11 43,145,109 (GRCm39) missense probably damaging 1.00
R6251:Atp10b UTSW 11 43,126,573 (GRCm39) missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43,092,065 (GRCm39) missense probably benign 0.24
R6394:Atp10b UTSW 11 43,116,464 (GRCm39) missense probably damaging 1.00
R6492:Atp10b UTSW 11 43,109,784 (GRCm39) missense probably damaging 1.00
R6769:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6771:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6775:Atp10b UTSW 11 43,113,040 (GRCm39) missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43,136,291 (GRCm39) missense probably damaging 1.00
R7322:Atp10b UTSW 11 43,103,374 (GRCm39) missense probably damaging 1.00
R7367:Atp10b UTSW 11 43,138,328 (GRCm39) missense probably damaging 1.00
R7538:Atp10b UTSW 11 43,116,373 (GRCm39) missense probably benign 0.04
R7708:Atp10b UTSW 11 43,092,970 (GRCm39) missense probably damaging 1.00
R7787:Atp10b UTSW 11 43,150,700 (GRCm39) missense possibly damaging 0.91
R8145:Atp10b UTSW 11 43,092,949 (GRCm39) missense probably damaging 1.00
R8406:Atp10b UTSW 11 43,093,984 (GRCm39) missense probably benign 0.00
R8503:Atp10b UTSW 11 43,113,066 (GRCm39) missense possibly damaging 0.92
R8542:Atp10b UTSW 11 43,121,208 (GRCm39) missense probably benign 0.18
R8744:Atp10b UTSW 11 43,121,177 (GRCm39) missense probably damaging 1.00
R8815:Atp10b UTSW 11 43,093,978 (GRCm39) missense possibly damaging 0.63
R8833:Atp10b UTSW 11 43,112,986 (GRCm39) missense probably damaging 1.00
R8880:Atp10b UTSW 11 43,106,811 (GRCm39) missense probably benign
R8989:Atp10b UTSW 11 43,136,269 (GRCm39) nonsense probably null
R8998:Atp10b UTSW 11 43,150,726 (GRCm39) makesense probably null
R9255:Atp10b UTSW 11 43,107,148 (GRCm39) missense probably damaging 1.00
R9281:Atp10b UTSW 11 43,116,458 (GRCm39) missense probably benign 0.11
R9345:Atp10b UTSW 11 43,094,024 (GRCm39) missense probably damaging 0.99
R9357:Atp10b UTSW 11 43,150,711 (GRCm39) missense probably benign 0.18
R9393:Atp10b UTSW 11 43,063,608 (GRCm39) missense probably damaging 1.00
R9516:Atp10b UTSW 11 43,121,224 (GRCm39) missense probably benign 0.02
R9644:Atp10b UTSW 11 43,042,659 (GRCm39) missense probably damaging 1.00
R9747:Atp10b UTSW 11 43,088,339 (GRCm39) missense probably benign
Z1177:Atp10b UTSW 11 43,044,176 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGTGCTACGAGGCTGAAAG -3'
(R):5'- ACTATCTCATGGGCTTGGGTC -3'

Sequencing Primer
(F):5'- TGATGAAGCAGCCCTAGTGC -3'
(R):5'- GGTCCATTGCAATGTTAGAGTAAG -3'
Posted On 2015-04-29