Mutagenetix > Incidental Mutations

Incidental Mutation 'R3971:Glp2r'

310982

Institutional Source

Beutler Lab

Gene Symbol

Glp2r

Ensembl Gene

ENSMUSG00000049928

Gene Name

glucagon-like peptide 2 receptor

Synonyms

GLP-2, 9530092J08Rik

MMRRC Submission

040839-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3971 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67661502-67771153 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67746815 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 130 (D130V)

Ref Sequence

ENSEMBL: ENSMUSP00000061560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000051765]

Predicted Effect

silent
Transcript: ENSMUST00000021289

SMART Domains

Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928

Domain	Start	End	E-Value	Type
Pfam:7tm_2	17	225	4.8e-54	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051765
AA Change: D130V

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000061560
Gene: ENSMUSG00000049928
AA Change: D130V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:HRM	53	122	3.4e-16	PFAM
Pfam:7tm_2	137	394	1.5e-79	PFAM

Meta Mutation Damage Score

0.1910

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.3%

Validation Efficiency

95% (38/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null mutation display defects in Paneth cell physiology, increased small bowel bacterial loads, and increased susceptibility to small bowel injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,833,799	I585T	probably damaging	Het
Aadat	C	T	8: 60,518,581	P147L	probably damaging	Het
Apbb1ip	T	A	2: 22,823,494	D120E	unknown	Het
Atp10b	A	G	11: 43,216,512	D791G	probably damaging	Het
Aunip	A	G	4: 134,523,469	K242E	possibly damaging	Het
BC067074	A	G	13: 113,317,126	E41G	probably damaging	Het
Ccdc80	A	G	16: 45,095,820	E313G	probably benign	Het
Cd72	C	T	4: 43,449,491	R275H	probably damaging	Het
Chrnb1	A	G	11: 69,792,916		probably benign	Het
Coro2b	C	T	9: 62,429,240	A251T	possibly damaging	Het
Ddr2	A	G	1: 169,988,417	F574L	probably damaging	Het
Dock1	G	A	7: 134,746,908	D284N	probably damaging	Het
Dync1h1	A	G	12: 110,665,965	H4506R	probably benign	Het
Fam174b	T	C	7: 73,766,600	V147A	probably damaging	Het
Gm18856	A	T	13: 13,964,848		probably benign	Het
Gm7247	A	G	14: 51,365,384	Y59C	probably damaging	Het
Hecw1	T	C	13: 14,236,929	D1062G	probably damaging	Het
Ifit2	A	G	19: 34,574,041	E327G	probably benign	Het
Ighv1-37	A	T	12: 114,896,459	S43T	probably damaging	Het
Man2b1	A	G	8: 85,085,391	N158S	probably damaging	Het
Mcoln1	T	A	8: 3,507,408	I138K	probably benign	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mrc2	G	A	11: 105,328,031	D193N	possibly damaging	Het
Myo5b	C	T	18: 74,740,527	L1501F	probably damaging	Het
Nckap1l	A	G	15: 103,462,560	K189E	probably damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr816	T	C	10: 129,911,873	N135S	probably benign	Het
Otop1	A	G	5: 38,300,189	I431V	probably benign	Het
Psma8	A	G	18: 14,757,387	K195E	possibly damaging	Het
Rbm25	A	G	12: 83,675,208	T723A	probably benign	Het
Sema3b	A	G	9: 107,600,368	S485P	probably benign	Het
Slc12a2	T	A	18: 57,930,196	L916Q	possibly damaging	Het
Spata31d1a	T	A	13: 59,702,157	D719V	possibly damaging	Het
Synj1	A	G	16: 90,991,603	S86P	probably damaging	Het
Tmem130	T	A	5: 144,755,321	H91L	probably benign	Het
Tsc2	T	C	17: 24,623,588	D288G	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Wac	T	C	18: 7,916,175	V303A	probably damaging	Het
Zfhx2	A	G	14: 55,074,475	V254A	probably benign	Het
Zfp993	A	G	4: 146,657,632	T138A	probably benign	Het

Other mutations in Glp2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01018:Glp2r	APN	11	67709644	missense	probably benign
IGL02244:Glp2r	APN	11	67721991	missense	probably damaging	1.00
IGL02484:Glp2r	APN	11	67740166	missense	possibly damaging	0.90
R0013:Glp2r	UTSW	11	67709712	missense	possibly damaging	0.88
R0013:Glp2r	UTSW	11	67709712	missense	possibly damaging	0.88
R0195:Glp2r	UTSW	11	67709708	missense	probably damaging	0.99
R1612:Glp2r	UTSW	11	67742207	missense	possibly damaging	0.46
R1699:Glp2r	UTSW	11	67757541	missense	probably benign	0.09
R1944:Glp2r	UTSW	11	67746792	missense	probably benign	0.01
R4417:Glp2r	UTSW	11	67664516	intron	probably benign
R4681:Glp2r	UTSW	11	67730627	splice site	probably null
R4914:Glp2r	UTSW	11	67757593	nonsense	probably null
R4918:Glp2r	UTSW	11	67757593	nonsense	probably null
R4938:Glp2r	UTSW	11	67757593	nonsense	probably null
R4940:Glp2r	UTSW	11	67757593	nonsense	probably null
R4941:Glp2r	UTSW	11	67746703	splice site	probably null
R4963:Glp2r	UTSW	11	67757593	nonsense	probably null
R4966:Glp2r	UTSW	11	67757593	nonsense	probably null
R5023:Glp2r	UTSW	11	67741032	missense	possibly damaging	0.82
R5121:Glp2r	UTSW	11	67722100	splice site	probably null
R5313:Glp2r	UTSW	11	67757531	missense	probably damaging	0.96
R5705:Glp2r	UTSW	11	67709739	missense	probably benign	0.30
R5790:Glp2r	UTSW	11	67764799	missense	probably damaging	1.00
R6074:Glp2r	UTSW	11	67746814	missense	unknown
R6595:Glp2r	UTSW	11	67764777	missense	probably benign	0.10
R6910:Glp2r	UTSW	11	67730671	missense	probably benign	0.28
R7511:Glp2r	UTSW	11	67757591	missense	probably damaging	0.98
R7627:Glp2r	UTSW	11	67746763	missense	unknown
R7681:Glp2r	UTSW	11	67709679	missense	probably benign	0.45
R7779:Glp2r	UTSW	11	67709783	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTTCTCGTGATGACCACCAG -3'
(R):5'- ATGGGCTCATACTCATGGGG -3'

Sequencing Primer
(F):5'- GTGATGACCACCAGACAAATTACAGG -3'
(R):5'- GTGATTTCTGAACTGTGCCAC -3'

Posted On

2015-04-29