Incidental Mutation 'R3971:Ccdc80'
ID310993
Institutional Source Beutler Lab
Gene Symbol Ccdc80
Ensembl Gene ENSMUSG00000022665
Gene Namecoiled-coil domain containing 80
SynonymsDRO1, Urb, Ssg1, 2610001E17Rik
MMRRC Submission 040839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3971 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45093402-45128077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45095820 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 313 (E313G)
Ref Sequence ENSEMBL: ENSMUSP00000097097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061050] [ENSMUST00000099498]
Predicted Effect probably benign
Transcript: ENSMUST00000061050
AA Change: E313G

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058752
Gene: ENSMUSG00000022665
AA Change: E313G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 141 270 2.2e-31 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 614 748 3.1e-36 PFAM
Pfam:DUF4174 770 901 2.1e-36 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099498
AA Change: E313G

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097097
Gene: ENSMUSG00000022665
AA Change: E313G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 140 271 8.9e-34 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 613 749 1.4e-21 PFAM
Pfam:DUF4174 769 902 3.5e-39 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155800
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 95% (38/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased adiposity, hyperglycemia, glucose intolerance, impaired insulin secretion, and altered energy intake and expenditure when fed a high-fat diet. Mice homozygous for a different null allele develop thyroid adenomas and ovarian carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,833,799 I585T probably damaging Het
Aadat C T 8: 60,518,581 P147L probably damaging Het
Apbb1ip T A 2: 22,823,494 D120E unknown Het
Atp10b A G 11: 43,216,512 D791G probably damaging Het
Aunip A G 4: 134,523,469 K242E possibly damaging Het
BC067074 A G 13: 113,317,126 E41G probably damaging Het
Cd72 C T 4: 43,449,491 R275H probably damaging Het
Chrnb1 A G 11: 69,792,916 probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Ddr2 A G 1: 169,988,417 F574L probably damaging Het
Dock1 G A 7: 134,746,908 D284N probably damaging Het
Dync1h1 A G 12: 110,665,965 H4506R probably benign Het
Fam174b T C 7: 73,766,600 V147A probably damaging Het
Glp2r T A 11: 67,746,815 D130V possibly damaging Het
Gm18856 A T 13: 13,964,848 probably benign Het
Gm7247 A G 14: 51,365,384 Y59C probably damaging Het
Hecw1 T C 13: 14,236,929 D1062G probably damaging Het
Ifit2 A G 19: 34,574,041 E327G probably benign Het
Ighv1-37 A T 12: 114,896,459 S43T probably damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mcoln1 T A 8: 3,507,408 I138K probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrc2 G A 11: 105,328,031 D193N possibly damaging Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nckap1l A G 15: 103,462,560 K189E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr816 T C 10: 129,911,873 N135S probably benign Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Psma8 A G 18: 14,757,387 K195E possibly damaging Het
Rbm25 A G 12: 83,675,208 T723A probably benign Het
Sema3b A G 9: 107,600,368 S485P probably benign Het
Slc12a2 T A 18: 57,930,196 L916Q possibly damaging Het
Spata31d1a T A 13: 59,702,157 D719V possibly damaging Het
Synj1 A G 16: 90,991,603 S86P probably damaging Het
Tmem130 T A 5: 144,755,321 H91L probably benign Het
Tsc2 T C 17: 24,623,588 D288G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wac T C 18: 7,916,175 V303A probably damaging Het
Zfhx2 A G 14: 55,074,475 V254A probably benign Het
Zfp993 A G 4: 146,657,632 T138A probably benign Het
Other mutations in Ccdc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Ccdc80 APN 16 45096264 missense probably benign 0.07
IGL01781:Ccdc80 APN 16 45126130 missense probably damaging 1.00
IGL01945:Ccdc80 APN 16 45118245 missense probably damaging 0.99
IGL02163:Ccdc80 APN 16 45096114 missense probably benign
IGL02223:Ccdc80 APN 16 45095603 missense probably damaging 1.00
IGL02573:Ccdc80 APN 16 45095589 missense probably damaging 1.00
IGL02675:Ccdc80 APN 16 45116332 missense probably damaging 1.00
IGL02689:Ccdc80 APN 16 45096409 nonsense probably null
R0219:Ccdc80 UTSW 16 45096483 missense probably damaging 1.00
R0383:Ccdc80 UTSW 16 45095369 missense probably damaging 1.00
R1537:Ccdc80 UTSW 16 45095936 missense probably benign 0.21
R1726:Ccdc80 UTSW 16 45096005 missense probably benign 0.04
R1885:Ccdc80 UTSW 16 45096720 missense probably benign 0.09
R2021:Ccdc80 UTSW 16 45122912 missense probably damaging 1.00
R2140:Ccdc80 UTSW 16 45127446 missense probably damaging 1.00
R2186:Ccdc80 UTSW 16 45118105 missense probably damaging 1.00
R3896:Ccdc80 UTSW 16 45096621 missense probably benign 0.11
R3941:Ccdc80 UTSW 16 45096092 missense probably benign
R4082:Ccdc80 UTSW 16 45122927 missense probably damaging 1.00
R4322:Ccdc80 UTSW 16 45095588 missense probably damaging 1.00
R4578:Ccdc80 UTSW 16 45095486 missense probably damaging 1.00
R4604:Ccdc80 UTSW 16 45095565 missense probably damaging 1.00
R4868:Ccdc80 UTSW 16 45104413 missense probably damaging 1.00
R4896:Ccdc80 UTSW 16 45095898 missense probably benign
R4921:Ccdc80 UTSW 16 45118167 missense probably damaging 1.00
R4979:Ccdc80 UTSW 16 45116287 missense possibly damaging 0.90
R5452:Ccdc80 UTSW 16 45118165 missense probably damaging 1.00
R5454:Ccdc80 UTSW 16 45127225 nonsense probably null
R5594:Ccdc80 UTSW 16 45116263 missense probably benign 0.00
R5661:Ccdc80 UTSW 16 45127445 missense probably damaging 1.00
R5701:Ccdc80 UTSW 16 45116378 missense possibly damaging 0.51
R6106:Ccdc80 UTSW 16 45096710 missense probably benign 0.00
R6393:Ccdc80 UTSW 16 45096465 missense possibly damaging 0.88
R6633:Ccdc80 UTSW 16 45094908 missense possibly damaging 0.95
R6943:Ccdc80 UTSW 16 45095082 missense probably benign 0.00
R7021:Ccdc80 UTSW 16 45104441 missense probably damaging 1.00
R7030:Ccdc80 UTSW 16 45122889 missense possibly damaging 0.60
R7208:Ccdc80 UTSW 16 45096710 missense probably benign 0.12
R7486:Ccdc80 UTSW 16 45126179 missense probably damaging 1.00
R7490:Ccdc80 UTSW 16 45096400 missense probably damaging 1.00
R7539:Ccdc80 UTSW 16 45095082 missense probably benign 0.01
R7562:Ccdc80 UTSW 16 45122903 missense probably damaging 1.00
X0012:Ccdc80 UTSW 16 45096425 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGGGCAAGTTTAGCATGGTGC -3'
(R):5'- TGCGGCTATTGTCACTACCC -3'

Sequencing Primer
(F):5'- TGGAGGAGCGCTACCCTTAC -3'
(R):5'- GCTATTGTCACTACCCGGGATG -3'
Posted On2015-04-29