Mutagenetix > Incidental Mutation

Incidental Mutation 'R3972:Trmt1l'

311004

Institutional Source

Beutler Lab

Gene Symbol

Trmt1l

Ensembl Gene

ENSMUSG00000053286

Gene Name

tRNA methyltransferase 1 like

Synonyms

Trm1-like, 1190005F20Rik

MMRRC Submission

040840-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3972 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

151428542-151458161 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 151433883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 106 (N106D)

Ref Sequence

ENSEMBL: ENSMUSP00000068309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065625
AA Change: N106D

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: N106D

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	25	70	N/A	INTRINSIC
ZnF_C2H2	116	142	7.49e0	SMART
ZnF_C2H2	181	203	2.49e-1	SMART
Pfam:TRM	220	563	6.9e-60	PFAM
Pfam:TRM	595	684	6.8e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186244

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188179

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188843

Predicted Effect

probably benign
Transcript: ENSMUST00000189655

SMART Domains

Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

Domain	Start	End	E-Value	Type
ZnF_C2H2	28	50	1.1e-3	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alk	T	G	17: 71,985,447	D512A	probably benign	Het
Avl9	T	C	6: 56,743,408	F477S	probably damaging	Het
C7	C	T	15: 5,007,651	V582I	possibly damaging	Het
Cldn20	A	G	17: 3,532,639	N29S	probably benign	Het
Coro2b	C	T	9: 62,429,240	A251T	possibly damaging	Het
Dnah3	T	A	7: 120,086,720	D131V	probably damaging	Het
Dusp12	T	C	1: 170,879,775	K248R	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fgf1	T	C	18: 38,847,094	T76A	probably benign	Het
Gucy2c	C	T	6: 136,708,366	R859K	probably damaging	Het
Irf2bp1	T	A	7: 19,005,444	D336E	possibly damaging	Het
Lpar6	A	G	14: 73,239,073	H158R	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Lyst	T	C	13: 13,706,625	C2814R	possibly damaging	Het
Man2b1	A	G	8: 85,085,391	N158S	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mrpl16	A	G	19: 11,772,875	N41S	probably benign	Het
Myo5b	C	T	18: 74,740,527	L1501F	probably damaging	Het
Nudt9	G	T	5: 104,047,125	C29F	probably benign	Het
Olfr1423	G	T	19: 12,036,019	T241N	probably damaging	Het
Otop1	A	G	5: 38,300,189	I431V	probably benign	Het
Otp	T	G	13: 94,883,184	L181R	probably damaging	Het
Pde4a	A	G	9: 21,206,217	T592A	probably damaging	Het
Pi4ka	A	G	16: 17,293,875	Y1579H	probably damaging	Het
Rb1cc1	T	C	1: 6,249,000	V864A	probably benign	Het
Reln	A	T	5: 21,979,001	F1667I	probably damaging	Het
Serpinb10	T	A	1: 107,536,122	F45I	probably damaging	Het
Setdb1	A	T	3: 95,341,338	N422K	probably damaging	Het
Slc17a7	A	G	7: 45,169,910	I137V	possibly damaging	Het
Tet1	T	A	10: 62,813,726	E67D	probably damaging	Het
Tpcn1	C	A	5: 120,553,752		probably null	Het
Trav9-4	T	C	14: 53,676,420	Y44H	possibly damaging	Het
Ttll12	A	T	15: 83,582,096	L388Q	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubfd1	T	G	7: 122,067,433	S51A	probably benign	Het
Uckl1	T	C	2: 181,574,463	D148G	probably damaging	Het
Usp34	T	C	11: 23,457,803	L2571S	probably damaging	Het
Wdr75	T	C	1: 45,822,554	V718A	probably benign	Het
Zfp266	A	G	9: 20,500,150	S244P	probably damaging	Het
Zfp979	G	A	4: 147,618,419	Q25*	probably null	Het

Other mutations in Trmt1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Trmt1l	APN	1	151442712	critical splice donor site	probably null
IGL02175:Trmt1l	APN	1	151448484	missense	probably benign	0.00
IGL02348:Trmt1l	APN	1	151450006	missense	probably damaging	1.00
IGL02397:Trmt1l	APN	1	151439531	missense	probably damaging	1.00
IGL02582:Trmt1l	APN	1	151433785	splice site	probably benign
IGL03150:Trmt1l	APN	1	151453892	missense	probably benign	0.00
IGL03220:Trmt1l	APN	1	151440941	splice site	probably benign
Canyonlands	UTSW	1	151454048	nonsense	probably null
splendiforous	UTSW	1	151453148	missense	probably damaging	1.00
IGL03014:Trmt1l	UTSW	1	151457930	missense	probably damaging	0.99
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0240:Trmt1l	UTSW	1	151457454	unclassified	probably benign
R0267:Trmt1l	UTSW	1	151457675	unclassified	probably benign
R2084:Trmt1l	UTSW	1	151440854	missense	probably damaging	1.00
R2206:Trmt1l	UTSW	1	151435843	critical splice donor site	probably null
R2338:Trmt1l	UTSW	1	151428959	intron	probably benign
R2408:Trmt1l	UTSW	1	151439516	missense	possibly damaging	0.48
R2429:Trmt1l	UTSW	1	151433830	missense	probably damaging	1.00
R2520:Trmt1l	UTSW	1	151453945	missense	probably benign	0.14
R4092:Trmt1l	UTSW	1	151455033	missense	probably benign	0.18
R4361:Trmt1l	UTSW	1	151435875	intron	probably benign
R4411:Trmt1l	UTSW	1	151452154	missense	probably benign	0.02
R4419:Trmt1l	UTSW	1	151440808	missense	probably damaging	0.98
R4518:Trmt1l	UTSW	1	151448343	nonsense	probably null
R4614:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4617:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4618:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4647:Trmt1l	UTSW	1	151457881	missense	possibly damaging	0.86
R4653:Trmt1l	UTSW	1	151439569	missense	probably benign	0.00
R4734:Trmt1l	UTSW	1	151442637	missense	probably benign	0.32
R4873:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R4875:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R5026:Trmt1l	UTSW	1	151440876	missense	probably damaging	1.00
R5528:Trmt1l	UTSW	1	151454995	missense	probably benign
R5587:Trmt1l	UTSW	1	151435704	intron	probably benign
R5872:Trmt1l	UTSW	1	151440843	missense	probably damaging	1.00
R6060:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
R6169:Trmt1l	UTSW	1	151428953	intron	probably benign
R6333:Trmt1l	UTSW	1	151453934	missense	probably benign	0.15
R6906:Trmt1l	UTSW	1	151452175	missense	probably benign	0.03
R7269:Trmt1l	UTSW	1	151457788	missense	possibly damaging	0.81
R7574:Trmt1l	UTSW	1	151440840	missense	possibly damaging	0.95
R7740:Trmt1l	UTSW	1	151440888	missense	possibly damaging	0.47
R7760:Trmt1l	UTSW	1	151442674	missense	possibly damaging	0.93
R7984:Trmt1l	UTSW	1	151435738	missense	probably benign	0.02
R8257:Trmt1l	UTSW	1	151428878	start codon destroyed	probably null
R8286:Trmt1l	UTSW	1	151457792	missense	probably damaging	1.00
R8439:Trmt1l	UTSW	1	151449976	missense	probably benign	0.10
R8451:Trmt1l	UTSW	1	151448288	missense	unknown
R8514:Trmt1l	UTSW	1	151453991	missense	probably damaging	0.98
R9287:Trmt1l	UTSW	1	151453148	missense	probably damaging	1.00
R9423:Trmt1l	UTSW	1	151450066	missense	possibly damaging	0.90
R9622:Trmt1l	UTSW	1	151428959	nonsense	probably null
X0039:Trmt1l	UTSW	1	151454990	missense	possibly damaging	0.88
Z1176:Trmt1l	UTSW	1	151453113	missense	possibly damaging	0.72
Z1187:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1189:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1190:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1192:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GCATAAATGTCAACATGGTGTGAAC -3'
(R):5'- AGCTATGATACTGTTTCAGGATGTC -3'

Sequencing Primer
(F):5'- TGTCAACATGGTGTGAACAACTG -3'
(R):5'- TCATGAGTTGAAAAATGATGACCC -3'

Posted On

2015-04-29