Incidental Mutation 'R3972:Trmt1l'
ID311004
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene NametRNA methyltransferase 1 like
SynonymsTrm1-like, 1190005F20Rik
MMRRC Submission 040840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3972 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location151428542-151458161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151433883 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 106 (N106D)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065625
AA Change: N106D

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: N106D

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188843
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T G 17: 71,985,447 D512A probably benign Het
Avl9 T C 6: 56,743,408 F477S probably damaging Het
C7 C T 15: 5,007,651 V582I possibly damaging Het
Cldn20 A G 17: 3,532,639 N29S probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Dnah3 T A 7: 120,086,720 D131V probably damaging Het
Dusp12 T C 1: 170,879,775 K248R probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fgf1 T C 18: 38,847,094 T76A probably benign Het
Gucy2c C T 6: 136,708,366 R859K probably damaging Het
Irf2bp1 T A 7: 19,005,444 D336E possibly damaging Het
Lpar6 A G 14: 73,239,073 H158R probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Lyst T C 13: 13,706,625 C2814R possibly damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrpl16 A G 19: 11,772,875 N41S probably benign Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nudt9 G T 5: 104,047,125 C29F probably benign Het
Olfr1423 G T 19: 12,036,019 T241N probably damaging Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Otp T G 13: 94,883,184 L181R probably damaging Het
Pde4a A G 9: 21,206,217 T592A probably damaging Het
Pi4ka A G 16: 17,293,875 Y1579H probably damaging Het
Rb1cc1 T C 1: 6,249,000 V864A probably benign Het
Reln A T 5: 21,979,001 F1667I probably damaging Het
Serpinb10 T A 1: 107,536,122 F45I probably damaging Het
Setdb1 A T 3: 95,341,338 N422K probably damaging Het
Slc17a7 A G 7: 45,169,910 I137V possibly damaging Het
Tet1 T A 10: 62,813,726 E67D probably damaging Het
Tpcn1 C A 5: 120,553,752 probably null Het
Trav9-4 T C 14: 53,676,420 Y44H possibly damaging Het
Ttll12 A T 15: 83,582,096 L388Q probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubfd1 T G 7: 122,067,433 S51A probably benign Het
Uckl1 T C 2: 181,574,463 D148G probably damaging Het
Usp34 T C 11: 23,457,803 L2571S probably damaging Het
Wdr75 T C 1: 45,822,554 V718A probably benign Het
Zfp266 A G 9: 20,500,150 S244P probably damaging Het
Zfp979 G A 4: 147,618,419 Q25* probably null Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151442712 critical splice donor site probably null
IGL02175:Trmt1l APN 1 151448484 missense probably benign 0.00
IGL02348:Trmt1l APN 1 151450006 missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151439531 missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151433785 splice site probably benign
IGL03150:Trmt1l APN 1 151453892 missense probably benign 0.00
IGL03220:Trmt1l APN 1 151440941 splice site probably benign
Canyonlands UTSW 1 151454048 nonsense probably null
IGL03014:Trmt1l UTSW 1 151457930 missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0240:Trmt1l UTSW 1 151457454 unclassified probably benign
R0267:Trmt1l UTSW 1 151457675 unclassified probably benign
R2084:Trmt1l UTSW 1 151440854 missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151435843 critical splice donor site probably null
R2338:Trmt1l UTSW 1 151428959 intron probably benign
R2408:Trmt1l UTSW 1 151439516 missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151433830 missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151453945 missense probably benign 0.14
R4092:Trmt1l UTSW 1 151455033 missense probably benign 0.18
R4361:Trmt1l UTSW 1 151435875 intron probably benign
R4411:Trmt1l UTSW 1 151452154 missense probably benign 0.02
R4419:Trmt1l UTSW 1 151440808 missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151448343 nonsense probably null
R4614:Trmt1l UTSW 1 151454048 nonsense probably null
R4617:Trmt1l UTSW 1 151454048 nonsense probably null
R4618:Trmt1l UTSW 1 151454048 nonsense probably null
R4647:Trmt1l UTSW 1 151457881 missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151439569 missense probably benign 0.00
R4734:Trmt1l UTSW 1 151442637 missense probably benign 0.32
R4873:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R4875:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R5026:Trmt1l UTSW 1 151440876 missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151454995 missense probably benign
R5587:Trmt1l UTSW 1 151435704 intron probably benign
R5872:Trmt1l UTSW 1 151440843 missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151428953 intron probably benign
R6333:Trmt1l UTSW 1 151453934 missense probably benign 0.15
R6906:Trmt1l UTSW 1 151452175 missense probably benign 0.03
R7269:Trmt1l UTSW 1 151457788 missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151440840 missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151440888 missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151442674 missense possibly damaging 0.93
X0039:Trmt1l UTSW 1 151454990 missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151453113 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCATAAATGTCAACATGGTGTGAAC -3'
(R):5'- AGCTATGATACTGTTTCAGGATGTC -3'

Sequencing Primer
(F):5'- TGTCAACATGGTGTGAACAACTG -3'
(R):5'- TCATGAGTTGAAAAATGATGACCC -3'
Posted On2015-04-29