Incidental Mutation 'R3972:Reln'
ID 311013
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
MMRRC Submission 040840-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R3972 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 21884454-22344702 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21979001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1667 (F1667I)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: F1667I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: F1667I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161353
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: F1667I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: F1667I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T G 17: 71,985,447 (GRCm38) D512A probably benign Het
Avl9 T C 6: 56,743,408 (GRCm38) F477S probably damaging Het
C7 C T 15: 5,007,651 (GRCm38) V582I possibly damaging Het
Cldn20 A G 17: 3,532,639 (GRCm38) N29S probably benign Het
Coro2b C T 9: 62,429,240 (GRCm38) A251T possibly damaging Het
Dnah3 T A 7: 120,086,720 (GRCm38) D131V probably damaging Het
Dusp12 T C 1: 170,879,775 (GRCm38) K248R probably damaging Het
Fat3 G A 9: 15,998,271 (GRCm38) S2145F probably damaging Het
Fgf1 T C 18: 38,847,094 (GRCm38) T76A probably benign Het
Gucy2c C T 6: 136,708,366 (GRCm38) R859K probably damaging Het
Irf2bp1 T A 7: 19,005,444 (GRCm38) D336E possibly damaging Het
Lpar6 A G 14: 73,239,073 (GRCm38) H158R probably benign Het
Ltbp3 G A 19: 5,754,022 (GRCm38) R854Q probably benign Het
Lyst T C 13: 13,706,625 (GRCm38) C2814R possibly damaging Het
Man2b1 A G 8: 85,085,391 (GRCm38) N158S probably damaging Het
Mki67 A C 7: 135,696,130 (GRCm38) S2392A probably benign Het
Mrpl16 A G 19: 11,772,875 (GRCm38) N41S probably benign Het
Myo5b C T 18: 74,740,527 (GRCm38) L1501F probably damaging Het
Nudt9 G T 5: 104,047,125 (GRCm38) C29F probably benign Het
Olfr1423 G T 19: 12,036,019 (GRCm38) T241N probably damaging Het
Otop1 A G 5: 38,300,189 (GRCm38) I431V probably benign Het
Otp T G 13: 94,883,184 (GRCm38) L181R probably damaging Het
Pde4a A G 9: 21,206,217 (GRCm38) T592A probably damaging Het
Pi4ka A G 16: 17,293,875 (GRCm38) Y1579H probably damaging Het
Rb1cc1 T C 1: 6,249,000 (GRCm38) V864A probably benign Het
Serpinb10 T A 1: 107,536,122 (GRCm38) F45I probably damaging Het
Setdb1 A T 3: 95,341,338 (GRCm38) N422K probably damaging Het
Slc17a7 A G 7: 45,169,910 (GRCm38) I137V possibly damaging Het
Tet1 T A 10: 62,813,726 (GRCm38) E67D probably damaging Het
Tpcn1 C A 5: 120,553,752 (GRCm38) probably null Het
Trav9-4 T C 14: 53,676,420 (GRCm38) Y44H possibly damaging Het
Trmt1l A G 1: 151,433,883 (GRCm38) N106D possibly damaging Het
Ttll12 A T 15: 83,582,096 (GRCm38) L388Q probably damaging Het
Ttn A T 2: 76,811,243 (GRCm38) L5176Q possibly damaging Het
Ubfd1 T G 7: 122,067,433 (GRCm38) S51A probably benign Het
Uckl1 T C 2: 181,574,463 (GRCm38) D148G probably damaging Het
Usp34 T C 11: 23,457,803 (GRCm38) L2571S probably damaging Het
Wdr75 T C 1: 45,822,554 (GRCm38) V718A probably benign Het
Zfp266 A G 9: 20,500,150 (GRCm38) S244P probably damaging Het
Zfp979 G A 4: 147,618,419 (GRCm38) Q25* probably null Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL00091:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL00432:Reln APN 5 22,010,127 (GRCm38) missense probably damaging 1.00
IGL00433:Reln APN 5 22,045,009 (GRCm38) missense probably damaging 1.00
IGL00576:Reln APN 5 22,154,950 (GRCm38) missense probably benign 0.01
IGL00755:Reln APN 5 22,060,380 (GRCm38) missense probably damaging 0.98
IGL00777:Reln APN 5 22,018,850 (GRCm38) critical splice donor site probably null
IGL00900:Reln APN 5 21,980,117 (GRCm38) missense probably damaging 0.98
IGL01067:Reln APN 5 21,979,666 (GRCm38) missense probably damaging 1.00
IGL01104:Reln APN 5 21,986,967 (GRCm38) missense probably damaging 0.99
IGL01141:Reln APN 5 21,969,033 (GRCm38) missense probably damaging 1.00
IGL01141:Reln APN 5 21,919,069 (GRCm38) missense probably damaging 1.00
IGL01333:Reln APN 5 22,171,251 (GRCm38) missense probably damaging 0.99
IGL01341:Reln APN 5 21,969,079 (GRCm38) missense probably damaging 1.00
IGL01354:Reln APN 5 21,919,175 (GRCm38) nonsense probably null
IGL01361:Reln APN 5 21,919,021 (GRCm38) missense probably benign 0.06
IGL01446:Reln APN 5 21,969,317 (GRCm38) missense probably damaging 0.99
IGL01448:Reln APN 5 22,040,405 (GRCm38) missense probably benign 0.40
IGL01612:Reln APN 5 21,896,930 (GRCm38) missense probably damaging 0.99
IGL01695:Reln APN 5 21,920,438 (GRCm38) missense probably damaging 1.00
IGL01718:Reln APN 5 21,947,514 (GRCm38) missense possibly damaging 0.60
IGL01749:Reln APN 5 22,344,246 (GRCm38) nonsense probably null
IGL01875:Reln APN 5 21,904,717 (GRCm38) missense probably benign
IGL02013:Reln APN 5 21,950,879 (GRCm38) missense probably damaging 1.00
IGL02031:Reln APN 5 21,979,016 (GRCm38) missense probably damaging 0.99
IGL02186:Reln APN 5 21,909,958 (GRCm38) missense probably damaging 1.00
IGL02228:Reln APN 5 21,904,731 (GRCm38) missense probably damaging 0.99
IGL02248:Reln APN 5 21,910,992 (GRCm38) missense probably damaging 1.00
IGL02336:Reln APN 5 21,929,134 (GRCm38) missense probably damaging 1.00
IGL02352:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL02359:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL02376:Reln APN 5 22,080,791 (GRCm38) nonsense probably null
IGL02408:Reln APN 5 21,901,619 (GRCm38) missense probably benign 0.44
IGL02415:Reln APN 5 21,971,951 (GRCm38) missense possibly damaging 0.91
IGL02512:Reln APN 5 22,040,427 (GRCm38) missense probably benign 0.00
IGL02540:Reln APN 5 22,034,752 (GRCm38) missense probably damaging 0.96
IGL02624:Reln APN 5 22,103,357 (GRCm38) missense probably benign 0.09
IGL02720:Reln APN 5 21,997,941 (GRCm38) missense probably damaging 0.99
IGL02894:Reln APN 5 21,885,548 (GRCm38) missense possibly damaging 0.72
IGL02999:Reln APN 5 21,995,365 (GRCm38) missense probably damaging 1.00
IGL03125:Reln APN 5 21,910,844 (GRCm38) missense probably damaging 1.00
IGL03298:Reln APN 5 21,910,836 (GRCm38) missense probably damaging 0.99
Fishing UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
P0020:Reln UTSW 5 22,106,060 (GRCm38) missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22,286,896 (GRCm38) missense possibly damaging 0.71
R0018:Reln UTSW 5 21,925,371 (GRCm38) missense probably benign 0.01
R0105:Reln UTSW 5 22,048,815 (GRCm38) missense probably damaging 0.99
R0105:Reln UTSW 5 22,048,815 (GRCm38) missense probably damaging 0.99
R0127:Reln UTSW 5 22,004,136 (GRCm38) missense probably damaging 1.00
R0135:Reln UTSW 5 22,128,649 (GRCm38) missense probably damaging 0.99
R0144:Reln UTSW 5 21,948,449 (GRCm38) missense probably damaging 0.97
R0240:Reln UTSW 5 22,106,045 (GRCm38) missense probably benign 0.36
R0240:Reln UTSW 5 22,106,045 (GRCm38) missense probably benign 0.36
R0242:Reln UTSW 5 21,942,597 (GRCm38) critical splice donor site probably null
R0242:Reln UTSW 5 21,942,597 (GRCm38) critical splice donor site probably null
R0266:Reln UTSW 5 21,988,776 (GRCm38) missense probably damaging 1.00
R0269:Reln UTSW 5 21,920,537 (GRCm38) missense probably damaging 1.00
R0280:Reln UTSW 5 22,227,513 (GRCm38) splice site probably benign
R0333:Reln UTSW 5 21,929,242 (GRCm38) missense probably damaging 0.97
R0357:Reln UTSW 5 21,950,822 (GRCm38) missense probably damaging 1.00
R0359:Reln UTSW 5 22,048,800 (GRCm38) missense probably damaging 0.98
R0506:Reln UTSW 5 21,920,496 (GRCm38) missense probably damaging 0.97
R0534:Reln UTSW 5 21,947,408 (GRCm38) missense probably damaging 0.99
R0535:Reln UTSW 5 22,051,276 (GRCm38) splice site probably benign
R0541:Reln UTSW 5 21,980,109 (GRCm38) missense possibly damaging 0.88
R0615:Reln UTSW 5 22,010,150 (GRCm38) missense probably benign 0.36
R0617:Reln UTSW 5 21,920,537 (GRCm38) missense probably damaging 1.00
R0634:Reln UTSW 5 22,018,869 (GRCm38) missense probably damaging 1.00
R0653:Reln UTSW 5 21,913,230 (GRCm38) missense probably benign 0.44
R0704:Reln UTSW 5 21,896,811 (GRCm38) missense probably damaging 0.99
R0706:Reln UTSW 5 21,896,811 (GRCm38) missense probably damaging 0.99
R0959:Reln UTSW 5 22,227,628 (GRCm38) missense probably damaging 0.96
R1066:Reln UTSW 5 22,034,664 (GRCm38) missense probably damaging 1.00
R1110:Reln UTSW 5 22,034,775 (GRCm38) missense probably benign
R1163:Reln UTSW 5 21,899,029 (GRCm38) missense probably benign 0.03
R1222:Reln UTSW 5 21,986,955 (GRCm38) missense probably null 0.97
R1226:Reln UTSW 5 21,910,866 (GRCm38) missense probably damaging 1.00
R1440:Reln UTSW 5 22,128,602 (GRCm38) splice site probably benign
R1532:Reln UTSW 5 22,034,744 (GRCm38) missense probably damaging 0.99
R1552:Reln UTSW 5 21,960,378 (GRCm38) missense probably benign 0.01
R1565:Reln UTSW 5 21,925,213 (GRCm38) missense probably benign 0.05
R1618:Reln UTSW 5 22,060,368 (GRCm38) missense probably benign 0.01
R1636:Reln UTSW 5 21,998,683 (GRCm38) missense probably damaging 0.99
R1664:Reln UTSW 5 21,929,086 (GRCm38) missense probably damaging 1.00
R1716:Reln UTSW 5 21,955,095 (GRCm38) missense probably damaging 0.98
R1759:Reln UTSW 5 22,010,289 (GRCm38) missense probably damaging 0.99
R1835:Reln UTSW 5 21,979,002 (GRCm38) missense probably damaging 1.00
R1907:Reln UTSW 5 22,044,962 (GRCm38) critical splice donor site probably null
R1991:Reln UTSW 5 21,969,360 (GRCm38) missense possibly damaging 0.56
R2046:Reln UTSW 5 21,942,627 (GRCm38) missense probably benign 0.01
R2072:Reln UTSW 5 21,919,177 (GRCm38) missense probably damaging 1.00
R2103:Reln UTSW 5 21,969,360 (GRCm38) missense possibly damaging 0.56
R2119:Reln UTSW 5 22,019,000 (GRCm38) missense probably damaging 1.00
R2120:Reln UTSW 5 21,969,085 (GRCm38) missense probably damaging 1.00
R2216:Reln UTSW 5 22,048,005 (GRCm38) missense probably benign 0.30
R2219:Reln UTSW 5 21,972,047 (GRCm38) missense possibly damaging 0.88
R2228:Reln UTSW 5 21,987,078 (GRCm38) missense possibly damaging 0.69
R2306:Reln UTSW 5 21,896,786 (GRCm38) missense probably damaging 1.00
R2316:Reln UTSW 5 22,154,956 (GRCm38) missense probably benign 0.00
R2321:Reln UTSW 5 21,915,020 (GRCm38) missense probably damaging 0.99
R2512:Reln UTSW 5 21,979,690 (GRCm38) missense possibly damaging 0.89
R2519:Reln UTSW 5 22,344,369 (GRCm38) missense unknown
R2870:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2870:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R3195:Reln UTSW 5 22,040,420 (GRCm38) missense possibly damaging 0.72
R3545:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3546:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3547:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3706:Reln UTSW 5 21,995,589 (GRCm38) splice site probably benign
R3713:Reln UTSW 5 21,904,734 (GRCm38) missense probably damaging 0.99
R3770:Reln UTSW 5 21,948,566 (GRCm38) missense probably damaging 1.00
R3836:Reln UTSW 5 21,911,014 (GRCm38) missense probably damaging 1.00
R3887:Reln UTSW 5 21,910,849 (GRCm38) missense possibly damaging 0.92
R3975:Reln UTSW 5 21,995,366 (GRCm38) missense possibly damaging 0.57
R4022:Reln UTSW 5 22,227,630 (GRCm38) missense probably benign 0.45
R4044:Reln UTSW 5 22,128,632 (GRCm38) missense possibly damaging 0.82
R4107:Reln UTSW 5 22,034,584 (GRCm38) missense probably damaging 1.00
R4297:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4298:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4299:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4518:Reln UTSW 5 21,901,743 (GRCm38) missense probably benign 0.44
R4615:Reln UTSW 5 21,972,872 (GRCm38) missense possibly damaging 0.95
R4713:Reln UTSW 5 22,152,463 (GRCm38) missense probably benign 0.17
R4720:Reln UTSW 5 22,286,896 (GRCm38) missense possibly damaging 0.71
R4721:Reln UTSW 5 21,919,222 (GRCm38) missense probably damaging 0.99
R4771:Reln UTSW 5 22,049,700 (GRCm38) missense probably damaging 1.00
R4794:Reln UTSW 5 22,344,185 (GRCm38) missense probably damaging 0.98
R4840:Reln UTSW 5 22,018,846 (GRCm38) splice site probably null
R4860:Reln UTSW 5 21,901,751 (GRCm38) missense probably benign 0.06
R4860:Reln UTSW 5 21,901,751 (GRCm38) missense probably benign 0.06
R4896:Reln UTSW 5 21,955,238 (GRCm38) missense probably damaging 1.00
R4908:Reln UTSW 5 21,979,720 (GRCm38) missense probably benign 0.02
R4912:Reln UTSW 5 21,925,193 (GRCm38) missense probably benign 0.29
R4922:Reln UTSW 5 21,995,587 (GRCm38) critical splice acceptor site probably null
R4975:Reln UTSW 5 21,960,426 (GRCm38) missense probably damaging 1.00
R4976:Reln UTSW 5 21,971,870 (GRCm38) missense probably benign 0.05
R5020:Reln UTSW 5 22,034,638 (GRCm38) missense probably damaging 1.00
R5037:Reln UTSW 5 21,948,512 (GRCm38) missense probably damaging 1.00
R5082:Reln UTSW 5 21,896,077 (GRCm38) missense probably benign 0.00
R5119:Reln UTSW 5 21,971,870 (GRCm38) missense probably benign 0.05
R5125:Reln UTSW 5 21,913,241 (GRCm38) missense possibly damaging 0.78
R5137:Reln UTSW 5 21,955,181 (GRCm38) missense probably damaging 1.00
R5152:Reln UTSW 5 21,948,629 (GRCm38) missense probably damaging 1.00
R5154:Reln UTSW 5 21,988,765 (GRCm38) missense probably damaging 0.99
R5259:Reln UTSW 5 22,103,397 (GRCm38) missense possibly damaging 0.83
R5283:Reln UTSW 5 22,011,163 (GRCm38) missense probably damaging 1.00
R5386:Reln UTSW 5 22,039,529 (GRCm38) missense probably benign
R5400:Reln UTSW 5 21,979,714 (GRCm38) missense probably damaging 1.00
R5478:Reln UTSW 5 22,004,203 (GRCm38) missense probably benign 0.00
R5514:Reln UTSW 5 21,971,885 (GRCm38) missense possibly damaging 0.93
R5529:Reln UTSW 5 21,932,715 (GRCm38) missense possibly damaging 0.71
R5611:Reln UTSW 5 22,039,665 (GRCm38) nonsense probably null
R5648:Reln UTSW 5 21,998,572 (GRCm38) missense probably benign 0.04
R5649:Reln UTSW 5 21,901,625 (GRCm38) missense probably benign 0.33
R5744:Reln UTSW 5 22,106,083 (GRCm38) missense probably null 0.39
R5782:Reln UTSW 5 22,018,056 (GRCm38) missense probably benign 0.01
R5815:Reln UTSW 5 21,947,433 (GRCm38) missense probably damaging 0.99
R5838:Reln UTSW 5 21,899,113 (GRCm38) missense probably damaging 0.97
R6162:Reln UTSW 5 21,911,050 (GRCm38) missense probably damaging 1.00
R6219:Reln UTSW 5 21,948,596 (GRCm38) missense probably damaging 1.00
R6259:Reln UTSW 5 22,060,333 (GRCm38) missense probably damaging 0.99
R6279:Reln UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
R6299:Reln UTSW 5 22,286,944 (GRCm38) missense possibly damaging 0.71
R6300:Reln UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
R6314:Reln UTSW 5 22,152,484 (GRCm38) nonsense probably null
R6351:Reln UTSW 5 21,901,663 (GRCm38) nonsense probably null
R6369:Reln UTSW 5 22,051,361 (GRCm38) missense probably benign 0.03
R6371:Reln UTSW 5 21,995,513 (GRCm38) missense probably benign
R6374:Reln UTSW 5 22,080,714 (GRCm38) missense probably benign 0.06
R6425:Reln UTSW 5 21,911,020 (GRCm38) nonsense probably null
R6442:Reln UTSW 5 21,932,776 (GRCm38) missense probably benign
R6445:Reln UTSW 5 21,919,214 (GRCm38) missense probably benign 0.05
R6554:Reln UTSW 5 21,896,840 (GRCm38) missense probably damaging 1.00
R6641:Reln UTSW 5 21,929,134 (GRCm38) missense probably damaging 1.00
R6768:Reln UTSW 5 21,978,907 (GRCm38) missense probably damaging 0.99
R6859:Reln UTSW 5 22,034,570 (GRCm38) missense probably damaging 1.00
R6896:Reln UTSW 5 21,899,179 (GRCm38) missense probably benign 0.18
R6932:Reln UTSW 5 21,985,857 (GRCm38) missense probably benign 0.00
R6948:Reln UTSW 5 21,972,035 (GRCm38) missense probably damaging 1.00
R6959:Reln UTSW 5 21,976,564 (GRCm38) missense probably damaging 1.00
R7085:Reln UTSW 5 21,915,087 (GRCm38) nonsense probably null
R7091:Reln UTSW 5 21,899,029 (GRCm38) missense probably null 0.08
R7135:Reln UTSW 5 21,976,596 (GRCm38) missense possibly damaging 0.95
R7146:Reln UTSW 5 22,106,097 (GRCm38) missense probably damaging 0.97
R7167:Reln UTSW 5 21,942,620 (GRCm38) missense probably damaging 1.00
R7190:Reln UTSW 5 22,047,947 (GRCm38) missense probably damaging 1.00
R7256:Reln UTSW 5 21,978,923 (GRCm38) missense probably benign 0.03
R7393:Reln UTSW 5 21,976,351 (GRCm38) missense probably damaging 0.99
R7399:Reln UTSW 5 22,051,367 (GRCm38) missense probably damaging 0.99
R7400:Reln UTSW 5 21,971,934 (GRCm38) missense probably damaging 0.99
R7426:Reln UTSW 5 21,971,953 (GRCm38) missense probably damaging 1.00
R7463:Reln UTSW 5 22,103,435 (GRCm38) missense probably damaging 0.98
R7470:Reln UTSW 5 21,942,741 (GRCm38) missense probably damaging 0.99
R7473:Reln UTSW 5 21,929,127 (GRCm38) missense probably benign 0.25
R7501:Reln UTSW 5 22,227,638 (GRCm38) missense possibly damaging 0.91
R7542:Reln UTSW 5 21,955,181 (GRCm38) missense probably damaging 1.00
R7544:Reln UTSW 5 21,976,278 (GRCm38) nonsense probably null
R7588:Reln UTSW 5 21,885,568 (GRCm38) missense probably benign 0.03
R7631:Reln UTSW 5 21,971,935 (GRCm38) missense probably damaging 0.97
R7644:Reln UTSW 5 21,978,931 (GRCm38) missense probably benign 0.39
R7834:Reln UTSW 5 22,039,635 (GRCm38) missense possibly damaging 0.94
R7923:Reln UTSW 5 22,134,692 (GRCm38) missense probably benign 0.00
R7938:Reln UTSW 5 21,950,872 (GRCm38) missense probably damaging 0.97
R8006:Reln UTSW 5 21,899,084 (GRCm38) nonsense probably null
R8062:Reln UTSW 5 21,971,992 (GRCm38) missense probably benign 0.00
R8222:Reln UTSW 5 21,931,477 (GRCm38) nonsense probably null
R8266:Reln UTSW 5 22,018,087 (GRCm38) missense possibly damaging 0.62
R8267:Reln UTSW 5 22,004,112 (GRCm38) missense probably damaging 1.00
R8487:Reln UTSW 5 21,899,029 (GRCm38) missense probably benign 0.03
R8523:Reln UTSW 5 22,004,231 (GRCm38) missense probably damaging 1.00
R8751:Reln UTSW 5 21,942,674 (GRCm38) missense probably benign 0.37
R8801:Reln UTSW 5 21,950,856 (GRCm38) missense possibly damaging 0.94
R8802:Reln UTSW 5 21,925,259 (GRCm38) missense probably damaging 0.98
R8978:Reln UTSW 5 21,885,514 (GRCm38) missense possibly damaging 0.85
R8988:Reln UTSW 5 21,899,157 (GRCm38) missense probably damaging 0.97
R8995:Reln UTSW 5 21,979,579 (GRCm38) missense probably benign 0.00
R9022:Reln UTSW 5 21,976,615 (GRCm38) missense possibly damaging 0.66
R9042:Reln UTSW 5 22,048,038 (GRCm38) missense probably damaging 1.00
R9069:Reln UTSW 5 22,011,061 (GRCm38) missense probably damaging 1.00
R9089:Reln UTSW 5 21,925,200 (GRCm38) missense probably benign 0.01
R9126:Reln UTSW 5 21,955,196 (GRCm38) missense probably damaging 1.00
R9172:Reln UTSW 5 21,950,817 (GRCm38) critical splice donor site probably null
R9182:Reln UTSW 5 21,901,619 (GRCm38) missense probably benign 0.44
R9196:Reln UTSW 5 22,152,473 (GRCm38) missense probably damaging 1.00
R9211:Reln UTSW 5 22,344,202 (GRCm38) nonsense probably null
R9241:Reln UTSW 5 21,969,069 (GRCm38) missense probably damaging 0.99
R9244:Reln UTSW 5 21,915,153 (GRCm38) missense probably damaging 0.99
R9281:Reln UTSW 5 21,948,547 (GRCm38) missense probably damaging 1.00
R9295:Reln UTSW 5 22,004,211 (GRCm38) missense possibly damaging 0.95
R9303:Reln UTSW 5 21,988,707 (GRCm38) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,080,691 (GRCm38) missense probably benign 0.01
R9309:Reln UTSW 5 21,971,868 (GRCm38) missense probably benign 0.37
R9338:Reln UTSW 5 21,997,939 (GRCm38) missense probably damaging 0.98
R9381:Reln UTSW 5 22,344,204 (GRCm38) missense possibly damaging 0.93
R9430:Reln UTSW 5 21,915,107 (GRCm38) missense probably damaging 1.00
R9509:Reln UTSW 5 22,344,200 (GRCm38) missense possibly damaging 0.93
R9515:Reln UTSW 5 21,920,510 (GRCm38) missense possibly damaging 0.46
R9717:Reln UTSW 5 21,931,429 (GRCm38) missense probably benign 0.26
R9745:Reln UTSW 5 21,947,527 (GRCm38) missense probably damaging 1.00
R9778:Reln UTSW 5 21,950,945 (GRCm38) missense probably damaging 1.00
Z1176:Reln UTSW 5 21,979,024 (GRCm38) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,004,082 (GRCm38) missense probably damaging 0.96
Z1177:Reln UTSW 5 21,969,241 (GRCm38) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,227,636 (GRCm38) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,154,959 (GRCm38) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGTCTTACTTGGTGGCGAG -3'
(R):5'- TCAATGCAAATTTGAGGCCC -3'

Sequencing Primer
(F):5'- TGGCAGGTAGACCGTGAC -3'
(R):5'- TGCAAATTTGAGGCCCTAAAC -3'
Posted On 2015-04-29