Incidental Mutation 'R3972:Tpcn1'
ID311016
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Nametwo pore channel 1
Synonyms5730403B01Rik
MMRRC Submission 040840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3972 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120534153-120588673 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 120553752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426]
Predicted Effect probably null
Transcript: ENSMUST00000046426
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201971
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T G 17: 71,985,447 D512A probably benign Het
Avl9 T C 6: 56,743,408 F477S probably damaging Het
C7 C T 15: 5,007,651 V582I possibly damaging Het
Cldn20 A G 17: 3,532,639 N29S probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Dnah3 T A 7: 120,086,720 D131V probably damaging Het
Dusp12 T C 1: 170,879,775 K248R probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fgf1 T C 18: 38,847,094 T76A probably benign Het
Gucy2c C T 6: 136,708,366 R859K probably damaging Het
Irf2bp1 T A 7: 19,005,444 D336E possibly damaging Het
Lpar6 A G 14: 73,239,073 H158R probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Lyst T C 13: 13,706,625 C2814R possibly damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrpl16 A G 19: 11,772,875 N41S probably benign Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nudt9 G T 5: 104,047,125 C29F probably benign Het
Olfr1423 G T 19: 12,036,019 T241N probably damaging Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Otp T G 13: 94,883,184 L181R probably damaging Het
Pde4a A G 9: 21,206,217 T592A probably damaging Het
Pi4ka A G 16: 17,293,875 Y1579H probably damaging Het
Rb1cc1 T C 1: 6,249,000 V864A probably benign Het
Reln A T 5: 21,979,001 F1667I probably damaging Het
Serpinb10 T A 1: 107,536,122 F45I probably damaging Het
Setdb1 A T 3: 95,341,338 N422K probably damaging Het
Slc17a7 A G 7: 45,169,910 I137V possibly damaging Het
Tet1 T A 10: 62,813,726 E67D probably damaging Het
Trav9-4 T C 14: 53,676,420 Y44H possibly damaging Het
Trmt1l A G 1: 151,433,883 N106D possibly damaging Het
Ttll12 A T 15: 83,582,096 L388Q probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubfd1 T G 7: 122,067,433 S51A probably benign Het
Uckl1 T C 2: 181,574,463 D148G probably damaging Het
Usp34 T C 11: 23,457,803 L2571S probably damaging Het
Wdr75 T C 1: 45,822,554 V718A probably benign Het
Zfp266 A G 9: 20,500,150 S244P probably damaging Het
Zfp979 G A 4: 147,618,419 Q25* probably null Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1577:Tpcn1 UTSW 5 120544420 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R2497:Tpcn1 UTSW 5 120538998 splice site probably null
R3965:Tpcn1 UTSW 5 120556575 missense probably damaging 0.98
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4343:Tpcn1 UTSW 5 120560220 missense probably damaging 1.00
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4831:Tpcn1 UTSW 5 120553489 missense probably damaging 1.00
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5910:Tpcn1 UTSW 5 120547397 intron probably benign
R5939:Tpcn1 UTSW 5 120539827 missense probably damaging 1.00
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7629:Tpcn1 UTSW 5 120537937 missense probably benign 0.00
R7854:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
R8478:Tpcn1 UTSW 5 120560321 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGAAAGCTGTGTGCATG -3'
(R):5'- ATACTCCCATGTGCACTGC -3'

Sequencing Primer
(F):5'- CTTAGCCTCTAAGGATGCACC -3'
(R):5'- TGCACTGCACCTCCGCC -3'
Posted On2015-04-29