Incidental Mutation 'R3972:Gucy2c'
ID311019
Institutional Source Beutler Lab
Gene Symbol Gucy2c
Ensembl Gene ENSMUSG00000042638
Gene Nameguanylate cyclase 2c
SynonymsGC-C
MMRRC Submission 040840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3972 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136697284-136781765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136708366 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 859 (R859K)
Ref Sequence ENSEMBL: ENSMUSP00000077236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]
Predicted Effect probably damaging
Transcript: ENSMUST00000032338
AA Change: R883K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: R883K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 113 384 3.7e-8 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 498 744 3.4e-33 PFAM
Pfam:Pkinase 499 744 1e-26 PFAM
CYCc 787 982 2.68e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078095
AA Change: R859K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: R859K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 53 385 2.7e-41 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Pfam:Pkinase_Tyr 475 720 6.5e-32 PFAM
Pfam:Pkinase 480 720 7.2e-25 PFAM
CYCc 763 958 2.68e-107 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T G 17: 71,985,447 D512A probably benign Het
Avl9 T C 6: 56,743,408 F477S probably damaging Het
C7 C T 15: 5,007,651 V582I possibly damaging Het
Cldn20 A G 17: 3,532,639 N29S probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Dnah3 T A 7: 120,086,720 D131V probably damaging Het
Dusp12 T C 1: 170,879,775 K248R probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fgf1 T C 18: 38,847,094 T76A probably benign Het
Irf2bp1 T A 7: 19,005,444 D336E possibly damaging Het
Lpar6 A G 14: 73,239,073 H158R probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Lyst T C 13: 13,706,625 C2814R possibly damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrpl16 A G 19: 11,772,875 N41S probably benign Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nudt9 G T 5: 104,047,125 C29F probably benign Het
Olfr1423 G T 19: 12,036,019 T241N probably damaging Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Otp T G 13: 94,883,184 L181R probably damaging Het
Pde4a A G 9: 21,206,217 T592A probably damaging Het
Pi4ka A G 16: 17,293,875 Y1579H probably damaging Het
Rb1cc1 T C 1: 6,249,000 V864A probably benign Het
Reln A T 5: 21,979,001 F1667I probably damaging Het
Serpinb10 T A 1: 107,536,122 F45I probably damaging Het
Setdb1 A T 3: 95,341,338 N422K probably damaging Het
Slc17a7 A G 7: 45,169,910 I137V possibly damaging Het
Tet1 T A 10: 62,813,726 E67D probably damaging Het
Tpcn1 C A 5: 120,553,752 probably null Het
Trav9-4 T C 14: 53,676,420 Y44H possibly damaging Het
Trmt1l A G 1: 151,433,883 N106D possibly damaging Het
Ttll12 A T 15: 83,582,096 L388Q probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubfd1 T G 7: 122,067,433 S51A probably benign Het
Uckl1 T C 2: 181,574,463 D148G probably damaging Het
Usp34 T C 11: 23,457,803 L2571S probably damaging Het
Wdr75 T C 1: 45,822,554 V718A probably benign Het
Zfp266 A G 9: 20,500,150 S244P probably damaging Het
Zfp979 G A 4: 147,618,419 Q25* probably null Het
Other mutations in Gucy2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Gucy2c APN 6 136765614 missense probably benign 0.01
IGL01081:Gucy2c APN 6 136702739 missense probably damaging 1.00
IGL01285:Gucy2c APN 6 136709741 missense probably damaging 1.00
IGL01395:Gucy2c APN 6 136698029 missense probably damaging 1.00
IGL01408:Gucy2c APN 6 136698011 missense probably benign 0.19
IGL01752:Gucy2c APN 6 136770108 missense probably benign 0.10
IGL01766:Gucy2c APN 6 136715973 missense probably benign 0.43
IGL02245:Gucy2c APN 6 136729203 missense probably benign 0.00
IGL02648:Gucy2c APN 6 136729213 nonsense probably null
IGL02794:Gucy2c APN 6 136713148 missense probably damaging 1.00
IGL03023:Gucy2c APN 6 136702796 splice site probably null
IGL03178:Gucy2c APN 6 136729239 splice site probably benign
IGL03310:Gucy2c APN 6 136751046 missense probably benign
IGL03374:Gucy2c APN 6 136765630 missense probably benign 0.00
IGL03393:Gucy2c APN 6 136719667 missense probably benign 0.04
R0031:Gucy2c UTSW 6 136697999 missense probably damaging 0.99
R0128:Gucy2c UTSW 6 136704249 missense probably damaging 1.00
R0377:Gucy2c UTSW 6 136750917 critical splice donor site probably null
R0593:Gucy2c UTSW 6 136728335 missense probably damaging 0.99
R0613:Gucy2c UTSW 6 136760723 missense probably damaging 1.00
R0723:Gucy2c UTSW 6 136727801 splice site probably null
R0828:Gucy2c UTSW 6 136709748 missense probably damaging 1.00
R0837:Gucy2c UTSW 6 136722420 missense probably damaging 0.99
R0880:Gucy2c UTSW 6 136709832 critical splice acceptor site probably null
R1350:Gucy2c UTSW 6 136743914 critical splice donor site probably null
R1487:Gucy2c UTSW 6 136748826 missense possibly damaging 0.79
R1680:Gucy2c UTSW 6 136722493 missense probably damaging 1.00
R1751:Gucy2c UTSW 6 136748775 splice site probably benign
R1791:Gucy2c UTSW 6 136744027 missense probably damaging 1.00
R1953:Gucy2c UTSW 6 136704293 missense probably damaging 1.00
R2135:Gucy2c UTSW 6 136723728 missense probably damaging 1.00
R2227:Gucy2c UTSW 6 136702760 missense probably damaging 1.00
R2350:Gucy2c UTSW 6 136763074 missense probably damaging 0.98
R2906:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R2907:Gucy2c UTSW 6 136708387 missense probably damaging 1.00
R3699:Gucy2c UTSW 6 136770111 missense probably damaging 1.00
R4613:Gucy2c UTSW 6 136708321 missense probably damaging 1.00
R4732:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4733:Gucy2c UTSW 6 136767152 missense probably damaging 1.00
R4776:Gucy2c UTSW 6 136722514 missense probably damaging 1.00
R5087:Gucy2c UTSW 6 136767035 missense possibly damaging 0.69
R5284:Gucy2c UTSW 6 136763043 missense possibly damaging 0.56
R5366:Gucy2c UTSW 6 136720741 missense probably damaging 0.99
R5466:Gucy2c UTSW 6 136781465 nonsense probably null
R5911:Gucy2c UTSW 6 136722442 missense probably damaging 1.00
R6160:Gucy2c UTSW 6 136740686 nonsense probably null
R6367:Gucy2c UTSW 6 136709778 missense probably damaging 1.00
R6441:Gucy2c UTSW 6 136723761 missense probably damaging 0.98
R6812:Gucy2c UTSW 6 136697995 missense probably benign
R6865:Gucy2c UTSW 6 136770129 missense probably benign 0.13
R7065:Gucy2c UTSW 6 136720766 missense probably damaging 1.00
R7078:Gucy2c UTSW 6 136697939 missense probably benign 0.19
R7096:Gucy2c UTSW 6 136728341 missense probably benign 0.11
R7138:Gucy2c UTSW 6 136728344 missense probably damaging 1.00
R7343:Gucy2c UTSW 6 136702748 missense probably damaging 1.00
R7538:Gucy2c UTSW 6 136709744 missense probably damaging 1.00
R7587:Gucy2c UTSW 6 136704290 missense probably damaging 1.00
R7666:Gucy2c UTSW 6 136697968 missense probably benign
R7675:Gucy2c UTSW 6 136716032 missense possibly damaging 0.91
Z1088:Gucy2c UTSW 6 136743981 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAAACCATGCCCTGTGTGTTTTG -3'
(R):5'- TGGGCCCTGAATGAGGTAAAC -3'

Sequencing Primer
(F):5'- GAGTCTATGCCTTGTGTGTTCCAC -3'
(R):5'- TAAACAGGACTGCTCGATCTG -3'
Posted On2015-04-29