Incidental Mutation 'R3972:Zfp266'
ID311028
Institutional Source Beutler Lab
Gene Symbol Zfp266
Ensembl Gene ENSMUSG00000060510
Gene Namezinc finger protein 266
Synonyms
MMRRC Submission 040840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3972 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20495068-20521417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20500150 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 244 (S244P)
Ref Sequence ENSEMBL: ENSMUSP00000134217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068296] [ENSMUST00000174462] [ENSMUST00000215908]
Predicted Effect probably damaging
Transcript: ENSMUST00000068296
AA Change: S244P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066012
Gene: ENSMUSG00000060510
AA Change: S244P

DomainStartEndE-ValueType
KRAB 41 101 1.4e-27 SMART
internal_repeat_1 138 318 2.7e-16 PROSPERO
ZnF_C2H2 343 365 7.78e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
ZnF_C2H2 399 421 2.27e-4 SMART
ZnF_C2H2 427 449 2.47e-5 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 1.47e-3 SMART
ZnF_C2H2 511 533 5.81e-2 SMART
ZnF_C2H2 539 561 2.79e-4 SMART
ZnF_C2H2 567 589 2.09e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174462
AA Change: S244P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134217
Gene: ENSMUSG00000060510
AA Change: S244P

DomainStartEndE-ValueType
KRAB 41 101 1.4e-27 SMART
internal_repeat_1 138 318 2.7e-16 PROSPERO
ZnF_C2H2 343 365 7.78e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
ZnF_C2H2 399 421 2.27e-4 SMART
ZnF_C2H2 427 449 2.47e-5 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 1.47e-3 SMART
ZnF_C2H2 511 533 5.81e-2 SMART
ZnF_C2H2 539 561 2.79e-4 SMART
ZnF_C2H2 567 589 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Predicted Effect probably benign
Transcript: ENSMUST00000215908
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing many tandem zinc-finger motifs. Zinc fingers are protein or nucleic acid-binding domains, and may be involved in a variety of functions, including regulation of transcription. This gene is located in a cluster of similar genes encoding zinc finger proteins on chromosome 19. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T G 17: 71,985,447 D512A probably benign Het
Avl9 T C 6: 56,743,408 F477S probably damaging Het
C7 C T 15: 5,007,651 V582I possibly damaging Het
Cldn20 A G 17: 3,532,639 N29S probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Dnah3 T A 7: 120,086,720 D131V probably damaging Het
Dusp12 T C 1: 170,879,775 K248R probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fgf1 T C 18: 38,847,094 T76A probably benign Het
Gucy2c C T 6: 136,708,366 R859K probably damaging Het
Irf2bp1 T A 7: 19,005,444 D336E possibly damaging Het
Lpar6 A G 14: 73,239,073 H158R probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Lyst T C 13: 13,706,625 C2814R possibly damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrpl16 A G 19: 11,772,875 N41S probably benign Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nudt9 G T 5: 104,047,125 C29F probably benign Het
Olfr1423 G T 19: 12,036,019 T241N probably damaging Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Otp T G 13: 94,883,184 L181R probably damaging Het
Pde4a A G 9: 21,206,217 T592A probably damaging Het
Pi4ka A G 16: 17,293,875 Y1579H probably damaging Het
Rb1cc1 T C 1: 6,249,000 V864A probably benign Het
Reln A T 5: 21,979,001 F1667I probably damaging Het
Serpinb10 T A 1: 107,536,122 F45I probably damaging Het
Setdb1 A T 3: 95,341,338 N422K probably damaging Het
Slc17a7 A G 7: 45,169,910 I137V possibly damaging Het
Tet1 T A 10: 62,813,726 E67D probably damaging Het
Tpcn1 C A 5: 120,553,752 probably null Het
Trav9-4 T C 14: 53,676,420 Y44H possibly damaging Het
Trmt1l A G 1: 151,433,883 N106D possibly damaging Het
Ttll12 A T 15: 83,582,096 L388Q probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubfd1 T G 7: 122,067,433 S51A probably benign Het
Uckl1 T C 2: 181,574,463 D148G probably damaging Het
Usp34 T C 11: 23,457,803 L2571S probably damaging Het
Wdr75 T C 1: 45,822,554 V718A probably benign Het
Zfp979 G A 4: 147,618,419 Q25* probably null Het
Other mutations in Zfp266
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4453001:Zfp266 UTSW 9 20506003 missense probably benign
R0744:Zfp266 UTSW 9 20499799 missense probably damaging 1.00
R0836:Zfp266 UTSW 9 20499799 missense probably damaging 1.00
R2180:Zfp266 UTSW 9 20499679 missense probably damaging 1.00
R2422:Zfp266 UTSW 9 20499262 missense possibly damaging 0.89
R3085:Zfp266 UTSW 9 20500944 missense probably damaging 0.99
R3791:Zfp266 UTSW 9 20499481 missense probably damaging 0.99
R5378:Zfp266 UTSW 9 20499363 missense probably damaging 1.00
R5529:Zfp266 UTSW 9 20506734 missense probably damaging 0.99
R5788:Zfp266 UTSW 9 20506036 missense probably damaging 0.98
R6476:Zfp266 UTSW 9 20499281 missense probably damaging 1.00
R6901:Zfp266 UTSW 9 20499599 nonsense probably null
R7326:Zfp266 UTSW 9 20502095 missense probably benign 0.03
R7417:Zfp266 UTSW 9 20500936 missense probably benign
R7783:Zfp266 UTSW 9 20500330 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGCCCGAGTACTGAGTAAAG -3'
(R):5'- AGTGTAACTGGTATGGGAAAGACAT -3'

Sequencing Primer
(F):5'- CCCATGGGATTATTAAGGCATGC -3'
(R):5'- AGACATTCTTTCTTTGCTCAAGG -3'
Posted On2015-04-29