Mutagenetix > Incidental Mutations

Incidental Mutation 'R3972:Tet1'

311031

Institutional Source

Beutler Lab

Gene Symbol

Tet1

Ensembl Gene

ENSMUSG00000047146

Gene Name

tet methylcytosine dioxygenase 1

Synonyms

BB001228, 2510010B09Rik, D10Ertd17e, Cxxc6

MMRRC Submission

040840-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3972 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62804570-62908996 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 62813726 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 67 (E67D)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174121] [ENSMUST00000174189]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050826
AA Change: E1665D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: E1665D

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
Pfam:zf-CXXC	566	607	2.5e-11	PFAM
low complexity region	884	902	N/A	INTRINSIC
low complexity region	1087	1106	N/A	INTRINSIC
Tet_JBP	1528	1931	1e-171	SMART
low complexity region	1944	1956	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000173087
AA Change: E67D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133706
Gene: ENSMUSG00000047146
AA Change: E67D

Domain	Start	End	E-Value	Type
Tet_JBP	2	138	2.64e-3	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000173905
AA Change: N61I

SMART Domains

Protein: ENSMUSP00000134571
Gene: ENSMUSG00000047146
AA Change: N61I

Domain	Start	End	E-Value	Type
Pfam:Tet_JBP	1	61	2.4e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000174121
AA Change: E68D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134328
Gene: ENSMUSG00000047146
AA Change: E68D

Domain	Start	End	E-Value	Type
Tet_JBP	1	352	1.49e-83	SMART
low complexity region	365	377	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174189
AA Change: E1697D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: E1697D

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
Pfam:zf-CXXC	566	607	2.7e-10	PFAM
low complexity region	884	902	N/A	INTRINSIC
low complexity region	1087	1106	N/A	INTRINSIC
Tet_JBP	1528	1963	7.36e-170	SMART
low complexity region	1976	1988	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alk	T	G	17: 71,985,447	D512A	probably benign	Het
Avl9	T	C	6: 56,743,408	F477S	probably damaging	Het
C7	C	T	15: 5,007,651	V582I	possibly damaging	Het
Cldn20	A	G	17: 3,532,639	N29S	probably benign	Het
Coro2b	C	T	9: 62,429,240	A251T	possibly damaging	Het
Dnah3	T	A	7: 120,086,720	D131V	probably damaging	Het
Dusp12	T	C	1: 170,879,775	K248R	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fgf1	T	C	18: 38,847,094	T76A	probably benign	Het
Gucy2c	C	T	6: 136,708,366	R859K	probably damaging	Het
Irf2bp1	T	A	7: 19,005,444	D336E	possibly damaging	Het
Lpar6	A	G	14: 73,239,073	H158R	probably benign	Het
Ltbp3	G	A	19: 5,754,022	R854Q	probably benign	Het
Lyst	T	C	13: 13,706,625	C2814R	possibly damaging	Het
Man2b1	A	G	8: 85,085,391	N158S	probably damaging	Het
Mki67	A	C	7: 135,696,130	S2392A	probably benign	Het
Mrpl16	A	G	19: 11,772,875	N41S	probably benign	Het
Myo5b	C	T	18: 74,740,527	L1501F	probably damaging	Het
Nudt9	G	T	5: 104,047,125	C29F	probably benign	Het
Olfr1423	G	T	19: 12,036,019	T241N	probably damaging	Het
Otop1	A	G	5: 38,300,189	I431V	probably benign	Het
Otp	T	G	13: 94,883,184	L181R	probably damaging	Het
Pde4a	A	G	9: 21,206,217	T592A	probably damaging	Het
Pi4ka	A	G	16: 17,293,875	Y1579H	probably damaging	Het
Rb1cc1	T	C	1: 6,249,000	V864A	probably benign	Het
Reln	A	T	5: 21,979,001	F1667I	probably damaging	Het
Serpinb10	T	A	1: 107,536,122	F45I	probably damaging	Het
Setdb1	A	T	3: 95,341,338	N422K	probably damaging	Het
Slc17a7	A	G	7: 45,169,910	I137V	possibly damaging	Het
Tpcn1	C	A	5: 120,553,752		probably null	Het
Trav9-4	T	C	14: 53,676,420	Y44H	possibly damaging	Het
Trmt1l	A	G	1: 151,433,883	N106D	possibly damaging	Het
Ttll12	A	T	15: 83,582,096	L388Q	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubfd1	T	G	7: 122,067,433	S51A	probably benign	Het
Uckl1	T	C	2: 181,574,463	D148G	probably damaging	Het
Usp34	T	C	11: 23,457,803	L2571S	probably damaging	Het
Wdr75	T	C	1: 45,822,554	V718A	probably benign	Het
Zfp266	A	G	9: 20,500,150	S244P	probably damaging	Het
Zfp979	G	A	4: 147,618,419	Q25*	probably null	Het

Other mutations in Tet1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Tet1	APN	10	62814497	missense	probably damaging	1.00
IGL01079:Tet1	APN	10	62879473	missense	probably damaging	0.99
IGL01109:Tet1	APN	10	62879774	missense	probably benign
IGL01634:Tet1	APN	10	62878588	missense	possibly damaging	0.94
IGL02003:Tet1	APN	10	62816400	missense	possibly damaging	0.92
IGL02081:Tet1	APN	10	62813818	missense	probably damaging	1.00
IGL02100:Tet1	APN	10	62812728	missense	possibly damaging	0.92
IGL02228:Tet1	APN	10	62813734	missense	probably damaging	0.99
IGL02524:Tet1	APN	10	62878646	missense	probably damaging	1.00
IGL02539:Tet1	APN	10	62813019	missense	possibly damaging	0.60
IGL02608:Tet1	APN	10	62879609	missense	possibly damaging	0.82
IGL02608:Tet1	APN	10	62839087	missense	probably damaging	1.00
IGL02702:Tet1	APN	10	62879752	missense	possibly damaging	0.83
K7371:Tet1	UTSW	10	62879176	missense	probably benign
R0166:Tet1	UTSW	10	62840279	missense	probably benign	0.05
R0371:Tet1	UTSW	10	62878399	missense	probably damaging	0.97
R0373:Tet1	UTSW	10	62878209	nonsense	probably null
R0391:Tet1	UTSW	10	62814546	splice site	probably null
R0445:Tet1	UTSW	10	62879941	missense	probably benign	0.08
R1016:Tet1	UTSW	10	62879950	missense	probably benign
R1344:Tet1	UTSW	10	62814521	missense	probably damaging	1.00
R1546:Tet1	UTSW	10	62812910	missense	probably damaging	1.00
R1651:Tet1	UTSW	10	62879674	missense	probably damaging	1.00
R1725:Tet1	UTSW	10	62814477	missense	probably damaging	1.00
R1752:Tet1	UTSW	10	62812989	missense	probably damaging	0.99
R1834:Tet1	UTSW	10	62813665	missense	probably damaging	0.99
R1964:Tet1	UTSW	10	62812947	missense	possibly damaging	0.86
R2239:Tet1	UTSW	10	62879734	missense	probably benign	0.01
R2962:Tet1	UTSW	10	62814544	nonsense	probably null
R3084:Tet1	UTSW	10	62879621	missense	probably benign	0.34
R3086:Tet1	UTSW	10	62879621	missense	probably benign	0.34
R4622:Tet1	UTSW	10	62819474	missense	possibly damaging	0.92
R4674:Tet1	UTSW	10	62838848	missense	probably damaging	0.97
R4687:Tet1	UTSW	10	62838791	missense	probably benign	0.04
R4718:Tet1	UTSW	10	62813812	missense	probably damaging	0.96
R4801:Tet1	UTSW	10	62822663	missense	probably damaging	0.99
R4802:Tet1	UTSW	10	62822663	missense	probably damaging	0.99
R4903:Tet1	UTSW	10	62822658	missense	probably damaging	1.00
R5153:Tet1	UTSW	10	62878578	missense	possibly damaging	0.85
R5193:Tet1	UTSW	10	62838247	missense	probably benign	0.22
R5225:Tet1	UTSW	10	62838671	missense	probably damaging	1.00
R5437:Tet1	UTSW	10	62814451	missense	probably benign	0.01
R5465:Tet1	UTSW	10	62839777	missense	probably benign
R5535:Tet1	UTSW	10	62832907	missense	probably damaging	1.00
R5586:Tet1	UTSW	10	62878294	missense	probably damaging	1.00
R5763:Tet1	UTSW	10	62840068	missense	probably damaging	1.00
R5788:Tet1	UTSW	10	62839958	missense	possibly damaging	0.70
R5818:Tet1	UTSW	10	62816408	missense	possibly damaging	0.71
R5860:Tet1	UTSW	10	62812620	splice site	probably null
R5975:Tet1	UTSW	10	62879773	missense	probably benign	0.37
R6041:Tet1	UTSW	10	62813373	missense	probably damaging	0.98
R6092:Tet1	UTSW	10	62813715	missense	probably benign	0.10
R6132:Tet1	UTSW	10	62813300	missense	probably damaging	0.99
R6157:Tet1	UTSW	10	62839970	missense	probably damaging	0.98
R6520:Tet1	UTSW	10	62880013	start codon destroyed	probably null	0.53
R7210:Tet1	UTSW	10	62814501	missense	probably null	0.95
R7223:Tet1	UTSW	10	62813671	missense	possibly damaging	0.95
R7255:Tet1	UTSW	10	62822636	missense	probably benign	0.15
R7323:Tet1	UTSW	10	62880039	start gained	probably benign
R7472:Tet1	UTSW	10	62813350	missense	possibly damaging	0.84
R7507:Tet1	UTSW	10	62832892	critical splice donor site	probably null
R7522:Tet1	UTSW	10	62818983	missense	possibly damaging	0.82
R7849:Tet1	UTSW	10	62819473	missense	possibly damaging	0.83
R7879:Tet1	UTSW	10	62879046	missense	probably benign	0.03
R8073:Tet1	UTSW	10	62813353	missense	probably damaging	0.98
R8098:Tet1	UTSW	10	62879080	missense	probably damaging	1.00
R8147:Tet1	UTSW	10	62878807	missense	probably benign	0.01
R8355:Tet1	UTSW	10	62816450	missense	possibly damaging	0.89
R8545:Tet1	UTSW	10	62812939	missense	probably damaging	1.00
R8556:Tet1	UTSW	10	62840206	missense	probably benign	0.37
Z1177:Tet1	UTSW	10	62818985	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AAGCTATTTGGCACCTGGG -3'
(R):5'- TATATGAGTCTAAGGGGCCAGG -3'

Sequencing Primer
(F):5'- GCTGGCAGAGATCCTCTTC -3'
(R):5'- AGTCTAAGGGGCCAGGTTGTTG -3'

Posted On

2015-04-29