Incidental Mutation 'R3972:Ttll12'
ID311039
Institutional Source Beutler Lab
Gene Symbol Ttll12
Ensembl Gene ENSMUSG00000016757
Gene Nametubulin tyrosine ligase-like family, member 12
Synonyms
MMRRC Submission 040840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3972 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location83575090-83595157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83582096 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 388 (L388Q)
Ref Sequence ENSEMBL: ENSMUSP00000016901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016901] [ENSMUST00000136066]
Predicted Effect probably damaging
Transcript: ENSMUST00000016901
AA Change: L388Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016901
Gene: ENSMUSG00000016757
AA Change: L388Q

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
Pfam:TTL 341 637 7.4e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134334
Predicted Effect probably benign
Transcript: ENSMUST00000136066
SMART Domains Protein: ENSMUSP00000117161
Gene: ENSMUSG00000016757

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 66 79 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T G 17: 71,985,447 D512A probably benign Het
Avl9 T C 6: 56,743,408 F477S probably damaging Het
C7 C T 15: 5,007,651 V582I possibly damaging Het
Cldn20 A G 17: 3,532,639 N29S probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Dnah3 T A 7: 120,086,720 D131V probably damaging Het
Dusp12 T C 1: 170,879,775 K248R probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fgf1 T C 18: 38,847,094 T76A probably benign Het
Gucy2c C T 6: 136,708,366 R859K probably damaging Het
Irf2bp1 T A 7: 19,005,444 D336E possibly damaging Het
Lpar6 A G 14: 73,239,073 H158R probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Lyst T C 13: 13,706,625 C2814R possibly damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrpl16 A G 19: 11,772,875 N41S probably benign Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nudt9 G T 5: 104,047,125 C29F probably benign Het
Olfr1423 G T 19: 12,036,019 T241N probably damaging Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Otp T G 13: 94,883,184 L181R probably damaging Het
Pde4a A G 9: 21,206,217 T592A probably damaging Het
Pi4ka A G 16: 17,293,875 Y1579H probably damaging Het
Rb1cc1 T C 1: 6,249,000 V864A probably benign Het
Reln A T 5: 21,979,001 F1667I probably damaging Het
Serpinb10 T A 1: 107,536,122 F45I probably damaging Het
Setdb1 A T 3: 95,341,338 N422K probably damaging Het
Slc17a7 A G 7: 45,169,910 I137V possibly damaging Het
Tet1 T A 10: 62,813,726 E67D probably damaging Het
Tpcn1 C A 5: 120,553,752 probably null Het
Trav9-4 T C 14: 53,676,420 Y44H possibly damaging Het
Trmt1l A G 1: 151,433,883 N106D possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubfd1 T G 7: 122,067,433 S51A probably benign Het
Uckl1 T C 2: 181,574,463 D148G probably damaging Het
Usp34 T C 11: 23,457,803 L2571S probably damaging Het
Wdr75 T C 1: 45,822,554 V718A probably benign Het
Zfp266 A G 9: 20,500,150 S244P probably damaging Het
Zfp979 G A 4: 147,618,419 Q25* probably null Het
Other mutations in Ttll12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ttll12 APN 15 83578656 missense probably benign 0.15
IGL00942:Ttll12 APN 15 83582448 missense possibly damaging 0.65
IGL01746:Ttll12 APN 15 83578676 missense probably damaging 1.00
IGL02102:Ttll12 APN 15 83582063 missense probably damaging 1.00
IGL02475:Ttll12 APN 15 83587101 missense probably damaging 1.00
IGL02484:Ttll12 APN 15 83581696 missense possibly damaging 0.94
R0403:Ttll12 UTSW 15 83580658 splice site probably benign
R1477:Ttll12 UTSW 15 83580102 missense probably damaging 1.00
R1530:Ttll12 UTSW 15 83588655 missense probably damaging 1.00
R1925:Ttll12 UTSW 15 83581775 missense probably benign 0.06
R3508:Ttll12 UTSW 15 83580630 missense probably damaging 0.98
R4198:Ttll12 UTSW 15 83577013 missense probably damaging 1.00
R4200:Ttll12 UTSW 15 83577013 missense probably damaging 1.00
R4357:Ttll12 UTSW 15 83581757 missense probably damaging 1.00
R4740:Ttll12 UTSW 15 83580120 missense probably damaging 1.00
R5024:Ttll12 UTSW 15 83587113 missense probably damaging 1.00
R5870:Ttll12 UTSW 15 83577036 missense probably damaging 0.97
R6824:Ttll12 UTSW 15 83591377 critical splice donor site probably null
R7034:Ttll12 UTSW 15 83586885 missense probably benign
R7036:Ttll12 UTSW 15 83586885 missense probably benign
R7447:Ttll12 UTSW 15 83586975 missense probably damaging 1.00
R8496:Ttll12 UTSW 15 83577809 missense probably damaging 1.00
R8721:Ttll12 UTSW 15 83580583 missense probably damaging 1.00
Z1088:Ttll12 UTSW 15 83582078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCTGGTAGGTGCTCAG -3'
(R):5'- CATACCCAGTGCCTCTGATGAC -3'

Sequencing Primer
(F):5'- AGCTGGTAGGTGCTCAGCTAAG -3'
(R):5'- GGATGCTAAGCTGACCTCTCTG -3'
Posted On2015-04-29