Incidental Mutation 'R3977:Rc3h1'
ID311055
Institutional Source Beutler Lab
Gene Symbol Rc3h1
Ensembl Gene ENSMUSG00000040423
Gene NameRING CCCH (C3H) domains 1
Synonymsroquin, 5730557L09Rik
MMRRC Submission 040940-MU
Accession Numbers

Genbank: NM_001024952; MGI: 2685397

Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160906418-160974978 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 160959399 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035911] [ENSMUST00000035911] [ENSMUST00000161609] [ENSMUST00000161609]
PDB Structure
X-ray structure of the ROQ domain from murine Roquin-1 [X-RAY DIFFRACTION]
X-ray structure of the ROQ domain from murine Roquin-1 in complex with a 23-mer Tnf-CDE RNA [X-RAY DIFFRACTION]
Crystal structure of N-terminus of Roquin [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000035911
SMART Domains Protein: ENSMUSP00000037178
Gene: ENSMUSG00000040423

DomainStartEndE-ValueType
RING 14 53 5.9e-8 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 1.4e-4 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035911
SMART Domains Protein: ENSMUSP00000037178
Gene: ENSMUSG00000040423

DomainStartEndE-ValueType
RING 14 53 5.9e-8 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 1.4e-4 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161609
SMART Domains Protein: ENSMUSP00000124871
Gene: ENSMUSG00000040423

DomainStartEndE-ValueType
RING 14 53 1.25e-5 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 5.3e-7 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 1003 1011 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161609
SMART Domains Protein: ENSMUSP00000124871
Gene: ENSMUSG00000040423

DomainStartEndE-ValueType
RING 14 53 1.25e-5 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 5.3e-7 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 1003 1011 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing RING-type and C3H1-type zinc finger motifs. The encoded protein recognizes and binds to a constitutive decay element (CDE) in the 3' UTR of mRNAs, leading to mRNA deadenylation and degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: A single recessive mutation on this gene resulted in severe autoimmune disease with phenotype resembling human systemic lupus erythematosus. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Rc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
sanroque APN 1 160940830 synonymous probably benign
IGL00417:Rc3h1 APN 1 160955981 critical splice donor site probably null
IGL02302:Rc3h1 APN 1 160938105 splice site probably benign
IGL03053:Rc3h1 APN 1 160955817 missense probably benign
IGL03275:Rc3h1 APN 1 160959555 critical splice donor site probably null
curlyfry UTSW 1 160959399 critical splice acceptor site probably null
PIT4651001:Rc3h1 UTSW 1 160963540 missense probably benign 0.04
R0528:Rc3h1 UTSW 1 160967658 missense probably damaging 1.00
R0609:Rc3h1 UTSW 1 160930135 missense probably damaging 1.00
R1620:Rc3h1 UTSW 1 160954973 missense probably benign 0.02
R1661:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R1665:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R2027:Rc3h1 UTSW 1 160954937 missense probably benign 0.03
R2145:Rc3h1 UTSW 1 160930257 missense probably damaging 1.00
R2207:Rc3h1 UTSW 1 160940025 missense probably damaging 0.97
R2227:Rc3h1 UTSW 1 160963542 missense probably benign 0.07
R2348:Rc3h1 UTSW 1 160950860 missense probably damaging 1.00
R2925:Rc3h1 UTSW 1 160954976 missense probably damaging 1.00
R5071:Rc3h1 UTSW 1 160959477 missense possibly damaging 0.76
R5177:Rc3h1 UTSW 1 160951652 missense probably damaging 1.00
R5410:Rc3h1 UTSW 1 160964963 missense possibly damaging 0.47
R5421:Rc3h1 UTSW 1 160951830 critical splice donor site probably null
R5699:Rc3h1 UTSW 1 160930253 missense probably damaging 1.00
R5873:Rc3h1 UTSW 1 160959501 missense probably damaging 0.99
R7672:Rc3h1 UTSW 1 160950884 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCTGAAGGAAGTTGAAACTC -3'
(R):5'- CAAAAGCAAAGCTCAATTAGTTGTCCC -3'

Sequencing Primer
(F):5'- AGCTGCCATTAACAAATATGAAAGC -3'
(R):5'- GTCCTGGAACTCACTTGTAGACCAG -3'
Posted On2015-04-29