Incidental Mutation 'R3977:Sdccag3'
ID311057
Institutional Source Beutler Lab
Gene Symbol Sdccag3
Ensembl Gene ENSMUSG00000026927
Gene Nameserologically defined colon cancer antigen 3
Synonyms
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26382802-26389316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26384793 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 364 (N364I)
Ref Sequence ENSEMBL: ENSMUSP00000109737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028293] [ENSMUST00000035427] [ENSMUST00000076431] [ENSMUST00000077983] [ENSMUST00000114093] [ENSMUST00000114100] [ENSMUST00000114102] [ENSMUST00000114115] [ENSMUST00000139738]
Predicted Effect probably damaging
Transcript: ENSMUST00000028293
AA Change: N314I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028293
Gene: ENSMUSG00000026927
AA Change: N314I

DomainStartEndE-ValueType
coiled coil region 209 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035427
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076431
SMART Domains Protein: ENSMUSP00000075762
Gene: ENSMUSG00000026926

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 4.5e-47 PFAM
Pfam:Peptidase_M16_C 231 430 4.1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077983
AA Change: N291I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077133
Gene: ENSMUSG00000026927
AA Change: N291I

DomainStartEndE-ValueType
coiled coil region 186 298 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114093
SMART Domains Protein: ENSMUSP00000109727
Gene: ENSMUSG00000026926

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 1.6e-47 PFAM
Pfam:Peptidase_M16_C 231 420 9.6e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114100
AA Change: N341I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109735
Gene: ENSMUSG00000026927
AA Change: N341I

DomainStartEndE-ValueType
coiled coil region 236 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114102
AA Change: N364I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109737
Gene: ENSMUSG00000026927
AA Change: N364I

DomainStartEndE-ValueType
coiled coil region 259 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114115
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137814
Predicted Effect probably benign
Transcript: ENSMUST00000139738
SMART Domains Protein: ENSMUSP00000121256
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155643
Meta Mutation Damage Score 0.4273 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Sdccag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02480:Sdccag3 APN 2 26385120 missense probably damaging 0.98
IGL03293:Sdccag3 APN 2 26387676 splice site probably benign
R0385:Sdccag3 UTSW 2 26387659 missense possibly damaging 0.82
R1707:Sdccag3 UTSW 2 26387606 missense probably damaging 1.00
R2035:Sdccag3 UTSW 2 26383627 missense probably damaging 1.00
R3743:Sdccag3 UTSW 2 26388643 intron probably benign
R4592:Sdccag3 UTSW 2 26388897 unclassified probably benign
R5389:Sdccag3 UTSW 2 26385547 missense probably damaging 1.00
R6030:Sdccag3 UTSW 2 26386971 missense possibly damaging 0.71
R6030:Sdccag3 UTSW 2 26386971 missense possibly damaging 0.71
R6381:Sdccag3 UTSW 2 26385081 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTATAGTATGACTGAGCCGGTC -3'
(R):5'- AATAGTGTAAGCCAAGCACAGC -3'

Sequencing Primer
(F):5'- TGAGCCGGTCAGCACCTTTC -3'
(R):5'- GGATAGTTGTACATTTAAGGCCAGCC -3'
Posted On2015-04-29