Incidental Mutation 'R3977:Trp53rkb'
ID311059
Institutional Source Beutler Lab
Gene Symbol Trp53rkb
Ensembl Gene ENSMUSG00000042854
Gene Nametransformation related protein 53 regulating kinase B
SynonymsNori-2, 4933401B08Rik, Trp53rk, mNori-2p, PRPK, 5630401H01Rik
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R3977 (G1)
Quality Score98
Status Not validated
Chromosome2
Chromosomal Location166792531-166799505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 166795526 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 134 (A134V)
Ref Sequence ENSEMBL: ENSMUSP00000115353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065753] [ENSMUST00000151826]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051923
Predicted Effect probably benign
Transcript: ENSMUST00000065753
SMART Domains Protein: ENSMUSP00000066907
Gene: ENSMUSG00000042854

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 107 137 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151826
AA Change: A134V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115353
Gene: ENSMUSG00000042854
AA Change: A134V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 189 1.1e-6 PFAM
Pfam:Pkinase 25 201 5.8e-9 PFAM
Pfam:Kdo 31 216 1.4e-13 PFAM
Pfam:RIO1 36 185 3.8e-10 PFAM
low complexity region 219 230 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Trp53rkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Trp53rkb APN 2 166795394 missense probably damaging 1.00
R0200:Trp53rkb UTSW 2 166795683 missense probably damaging 1.00
R0841:Trp53rkb UTSW 2 166795510 missense probably benign 0.02
R1921:Trp53rkb UTSW 2 166795823 missense probably damaging 1.00
R2183:Trp53rkb UTSW 2 166793957 missense possibly damaging 0.52
R3116:Trp53rkb UTSW 2 166794089 intron probably benign
R3925:Trp53rkb UTSW 2 166795472 missense probably damaging 1.00
R4191:Trp53rkb UTSW 2 166795475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAACTGTCTGCCTGTGC -3'
(R):5'- TCTCCAGGACATAGAGGTCG -3'

Sequencing Primer
(F):5'- GCCTTCATGAAGATGCGCTC -3'
(R):5'- GACATAGAGGTCGACGCCTTTATC -3'
Posted On2015-04-29