Incidental Mutation 'R3977:Nras'
ID311061
Institutional Source Beutler Lab
Gene Symbol Nras
Ensembl Gene ENSMUSG00000027852
Gene Nameneuroblastoma ras oncogene
SynonymsN-ras
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103058285-103067914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103060225 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 46 (I46V)
Ref Sequence ENSEMBL: ENSMUSP00000143391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029445] [ENSMUST00000029446] [ENSMUST00000128264] [ENSMUST00000196355] [ENSMUST00000197488] [ENSMUST00000197678] [ENSMUST00000197827] [ENSMUST00000198180] [ENSMUST00000199049] [ENSMUST00000199240] [ENSMUST00000199367] [ENSMUST00000199420] [ENSMUST00000199571] [ENSMUST00000200069] [ENSMUST00000200457]
Predicted Effect probably benign
Transcript: ENSMUST00000029445
AA Change: I46V

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029445
Gene: ENSMUSG00000027852
AA Change: I46V

DomainStartEndE-ValueType
RAS 1 166 1.09e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029446
SMART Domains Protein: ENSMUSP00000029446
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128264
Predicted Effect probably benign
Transcript: ENSMUST00000196355
AA Change: I46V

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142438
Gene: ENSMUSG00000027852
AA Change: I46V

DomainStartEndE-ValueType
RAS 1 166 1.09e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197488
SMART Domains Protein: ENSMUSP00000143524
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 726 757 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197678
AA Change: I46V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142603
Gene: ENSMUSG00000027852
AA Change: I46V

DomainStartEndE-ValueType
RAS 1 150 4.08e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197827
SMART Domains Protein: ENSMUSP00000143503
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197844
Predicted Effect probably benign
Transcript: ENSMUST00000198174
Predicted Effect probably benign
Transcript: ENSMUST00000198180
SMART Domains Protein: ENSMUSP00000142983
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199049
AA Change: I46V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143644
Gene: ENSMUSG00000027852
AA Change: I46V

DomainStartEndE-ValueType
RAS 1 166 5.3e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199240
SMART Domains Protein: ENSMUSP00000143050
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 57 118 9e-22 SMART
CSP 220 283 3.8e-18 SMART
CSP 390 452 1.7e-17 SMART
CSP 545 608 1.4e-18 SMART
Pfam:SUZ-C 626 659 6.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199367
AA Change: I46V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143620
Gene: ENSMUSG00000027852
AA Change: I46V

DomainStartEndE-ValueType
small_GTPase 1 74 1.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199420
SMART Domains Protein: ENSMUSP00000142703
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199571
SMART Domains Protein: ENSMUSP00000143028
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199776
Predicted Effect probably benign
Transcript: ENSMUST00000200069
AA Change: I46V

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143391
Gene: ENSMUSG00000027852
AA Change: I46V

DomainStartEndE-ValueType
RAS 1 166 1.09e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200457
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This is an N-ras oncogene encoding a membrane protein that shuttles between the Golgi apparatus and the plasma membrane. This shuttling is regulated through palmitoylation and depalmitoylation by the ZDHHC9-GOLGA7 complex. The encoded protein, which has intrinsic GTPase activity, is activated by a guanine nucleotide-exchange factor and inactivated by a GTPase activating protein. Mutations in this gene have been associated with somatic rectal cancer, follicular thyroid cancer, autoimmune lymphoproliferative syndrome, Noonan syndrome, and juvenile myelomonocytic leukemia. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with no gross morphological or histological abnormalities, or defects in peripheral blood cell populations. Mice homozygous for an LTR insertion in intron 1 exhibit weight loss immune defectsand postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Nras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Nras APN 3 103058916 utr 5 prime probably benign
IGL01443:Nras APN 3 103062435 missense probably benign 0.21
IGL03327:Nras APN 3 103059024 missense probably damaging 1.00
R0697:Nras UTSW 3 103060300 missense possibly damaging 0.89
R1688:Nras UTSW 3 103060373 missense probably benign
R1753:Nras UTSW 3 103058979 missense probably damaging 1.00
R2296:Nras UTSW 3 103059034 critical splice donor site probably null
R3979:Nras UTSW 3 103060225 missense probably benign 0.10
R6087:Nras UTSW 3 103060321 missense probably damaging 1.00
R6194:Nras UTSW 3 103058953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCATAACTCAGGCTGGTTTTG -3'
(R):5'- AGAAAATATCCCCAGTACCTGTAGAG -3'

Sequencing Primer
(F):5'- TTGAAACAGGGTCTCACTGC -3'
(R):5'- CCTGTAGAGGTTAATATCTGCAAATG -3'
Posted On2015-04-29