Incidental Mutation 'R3977:Ptpn22'
ID311062
Institutional Source Beutler Lab
Gene Symbol Ptpn22
Ensembl Gene ENSMUSG00000027843
Gene Nameprotein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms70zpep, Ptpn8
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103859795-103912247 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 103873641 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000146071]
Predicted Effect probably benign
Transcript: ENSMUST00000029433
SMART Domains Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 2e-65 BLAST
PDB:1JEG|B 605 629 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000146071
SMART Domains Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 9e-66 BLAST
internal_repeat_1 567 629 1.92e-7 PROSPERO
internal_repeat_1 651 705 1.92e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198530
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice display antigen dependent increases in T cell proliferation and cytokine production, enlarged spleens and lymph nodes, increased spontaneous germinal center formation, increased B cell numbers, and increased serum IgG and IgE levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Ptpn22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Ptpn22 APN 3 103903374 missense probably benign 0.01
IGL01373:Ptpn22 APN 3 103886204 missense probably damaging 0.99
IGL01943:Ptpn22 APN 3 103886336 missense probably benign 0.02
IGL02092:Ptpn22 APN 3 103877321 missense probably damaging 1.00
IGL02431:Ptpn22 APN 3 103903397 missense probably benign 0.01
IGL02732:Ptpn22 APN 3 103886033 missense probably damaging 0.98
IGL02738:Ptpn22 APN 3 103874066 splice site probably benign
IGL03406:Ptpn22 APN 3 103912016 missense probably benign 0.14
R0490:Ptpn22 UTSW 3 103886179 missense probably damaging 1.00
R0494:Ptpn22 UTSW 3 103860455 missense probably damaging 1.00
R0626:Ptpn22 UTSW 3 103860405 start codon destroyed probably null 1.00
R0743:Ptpn22 UTSW 3 103902171 missense probably damaging 1.00
R1441:Ptpn22 UTSW 3 103874247 missense probably damaging 1.00
R1610:Ptpn22 UTSW 3 103902196 splice site probably null
R1698:Ptpn22 UTSW 3 103885798 missense probably benign 0.20
R1785:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1786:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1919:Ptpn22 UTSW 3 103876738 critical splice donor site probably null
R2045:Ptpn22 UTSW 3 103874021 missense possibly damaging 0.61
R4176:Ptpn22 UTSW 3 103886245 missense probably benign 0.00
R4478:Ptpn22 UTSW 3 103902064 intron probably benign
R5093:Ptpn22 UTSW 3 103882102 missense probably benign 0.39
R5579:Ptpn22 UTSW 3 103882139 splice site probably null
R6022:Ptpn22 UTSW 3 103886105 missense probably benign 0.00
R6110:Ptpn22 UTSW 3 103912015 missense probably damaging 0.96
R6387:Ptpn22 UTSW 3 103885386 missense probably benign 0.18
R7335:Ptpn22 UTSW 3 103886019 missense probably damaging 0.97
R7516:Ptpn22 UTSW 3 103885538 missense probably benign 0.16
R7523:Ptpn22 UTSW 3 103912015 missense probably damaging 0.96
R7583:Ptpn22 UTSW 3 103902114 missense probably benign 0.11
R8129:Ptpn22 UTSW 3 103890284 critical splice donor site probably null
R8141:Ptpn22 UTSW 3 103886327 missense possibly damaging 0.67
Z1177:Ptpn22 UTSW 3 103885700 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGCTCTTCCTGTATGTGATGCAC -3'
(R):5'- TCTAAGATTAAGAACAAGCGCTGGG -3'

Sequencing Primer
(F):5'- ACTGGCTCAGTCTTGCAAAG -3'
(R):5'- CAAGCGCTGGGTTAAAAACTG -3'
Posted On2015-04-29