Mutagenetix > Incidental Mutation

Incidental Mutation 'R3977:Ptpn22'

311062

Institutional Source

Beutler Lab

Gene Symbol

Ptpn22

Ensembl Gene

ENSMUSG00000027843

Gene Name

protein tyrosine phosphatase, non-receptor type 22 (lymphoid)

Synonyms

70zpep, Ptpn8

MMRRC Submission

040940-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.782) question?

Stock #

R3977 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103859795-103912247 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 103873641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000146071]

AlphaFold

P29352

Predicted Effect

probably benign
Transcript: ENSMUST00000029433

SMART Domains

Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
PTPc	23	291	3.32e-123	SMART
Blast:PTPc	305	502	2e-65	BLAST
PDB:1JEG\|B	605	629	2e-8	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000146071

SMART Domains

Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
PTPc	23	291	3.32e-123	SMART
Blast:PTPc	305	502	9e-66	BLAST
internal_repeat_1	567	629	1.92e-7	PROSPERO
internal_repeat_1	651	705	1.92e-7	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197997

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198530

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice display antigen dependent increases in T cell proliferation and cytokine production, enlarged spleens and lymph nodes, increased spontaneous germinal center formation, increased B cell numbers, and increased serum IgG and IgE levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	C	T	11: 105,981,838	P942L	possibly damaging	Het
Adam28	A	G	14: 68,610,994	V671A	probably benign	Het
Arfgef1	A	G	1: 10,209,634	V236A	probably benign	Het
B020004C17Rik	G	T	14: 57,017,188	M156I	possibly damaging	Het
Bicral	T	A	17: 46,830,991	M1L	unknown	Het
Brpf3	A	G	17: 28,807,042	E363G	possibly damaging	Het
Ccdc96	T	C	5: 36,485,166	L172P	possibly damaging	Het
Cln3	G	A	7: 126,580,136		probably benign	Het
Dnah7c	T	C	1: 46,628,911	I1526T	possibly damaging	Het
Fmo3	T	G	1: 162,958,578	E281A	probably damaging	Het
Frem2	A	G	3: 53,652,070	I1672T	probably benign	Het
Gbp2b	A	G	3: 142,603,709	I194V	probably benign	Het
Gprc6a	C	A	10: 51,621,101	V449L	probably benign	Het
Hk1	A	G	10: 62,290,319	V396A	probably benign	Het
Hoxc13	T	C	15: 102,921,240	V18A	possibly damaging	Het
Hr	A	G	14: 70,563,584	T699A	probably benign	Het
Il19	A	T	1: 130,936,033	C74S	probably damaging	Het
Krt2	T	C	15: 101,811,127	T703A	unknown	Het
Lrig2	A	T	3: 104,457,844	V664E	probably damaging	Het
Lrrc37a	T	C	11: 103,457,604	K2755R	unknown	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mbtd1	A	G	11: 93,905,175	N13D	probably benign	Het
Mfsd4b5	T	C	10: 39,974,708		probably benign	Het
Nras	A	G	3: 103,060,225	I46V	probably benign	Het
Oasl1	C	T	5: 114,932,898	T274I	probably damaging	Het
Ogfod2	C	A	5: 124,113,209		probably null	Het
Olfr1264	C	A	2: 90,021,745	G107V	probably damaging	Het
Olfr1369-ps1	T	A	13: 21,115,861	H56Q	probably benign	Het
Olfr1419	C	A	19: 11,870,505	R237L	possibly damaging	Het
Olfr1420	T	A	19: 11,896,516	F165Y	probably damaging	Het
Olfr774	C	T	10: 129,238,508	R120C	probably damaging	Het
Olfr96	T	C	17: 37,225,158	V11A	probably benign	Het
Pkmyt1	A	G	17: 23,735,331	M362V	probably benign	Het
Ppfia2	A	G	10: 106,830,629	T399A	possibly damaging	Het
Ppp1r12b	A	G	1: 134,765,975	S983P	probably benign	Het
Raph1	A	T	1: 60,498,523	D491E	probably benign	Het
Rc3h1	A	G	1: 160,959,399		probably null	Het
Rtn4	T	C	11: 29,693,819	L5P	probably benign	Het
Sdccag3	T	A	2: 26,384,793	N364I	probably damaging	Het
Slc23a4	C	T	6: 34,953,788	V400I	probably benign	Het
Slco1a5	A	G	6: 142,258,972		probably benign	Het
Smpd1	T	C	7: 105,555,901	F329S	probably benign	Het
Sycp2l	A	G	13: 41,141,964	I334M	probably damaging	Het
Tas2r103	A	G	6: 133,036,317	L262P	probably benign	Het
Ten1	G	A	11: 116,216,945		probably null	Het
Tfap2d	C	G	1: 19,104,494	S57C	possibly damaging	Het
Tnr	A	G	1: 159,892,023	M957V	probably benign	Het
Trbv13-3	A	G	6: 41,130,145		probably benign	Het
Trp53rkb	C	T	2: 166,795,526	A134V	possibly damaging	Het
Trp63	A	G	16: 25,820,740		probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Vmn2r74	T	C	7: 85,958,137	Y126C	probably benign	Het
Vmn2r96	T	A	17: 18,597,679	I698N	probably damaging	Het

Other mutations in Ptpn22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Ptpn22	APN	3	103903374	missense	probably benign	0.01
IGL01373:Ptpn22	APN	3	103886204	missense	probably damaging	0.99
IGL01943:Ptpn22	APN	3	103886336	missense	probably benign	0.02
IGL02092:Ptpn22	APN	3	103877321	missense	probably damaging	1.00
IGL02431:Ptpn22	APN	3	103903397	missense	probably benign	0.01
IGL02732:Ptpn22	APN	3	103886033	missense	probably damaging	0.98
IGL02738:Ptpn22	APN	3	103874066	splice site	probably benign
IGL03406:Ptpn22	APN	3	103912016	missense	probably benign	0.14
R0490:Ptpn22	UTSW	3	103886179	missense	probably damaging	1.00
R0494:Ptpn22	UTSW	3	103860455	missense	probably damaging	1.00
R0626:Ptpn22	UTSW	3	103860405	start codon destroyed	probably null	1.00
R0743:Ptpn22	UTSW	3	103902171	missense	probably damaging	1.00
R1441:Ptpn22	UTSW	3	103874247	missense	probably damaging	1.00
R1610:Ptpn22	UTSW	3	103902196	splice site	probably null
R1698:Ptpn22	UTSW	3	103885798	missense	probably benign	0.20
R1785:Ptpn22	UTSW	3	103874052	missense	probably damaging	0.99
R1786:Ptpn22	UTSW	3	103874052	missense	probably damaging	0.99
R1919:Ptpn22	UTSW	3	103876738	critical splice donor site	probably null
R2045:Ptpn22	UTSW	3	103874021	missense	possibly damaging	0.61
R4176:Ptpn22	UTSW	3	103886245	missense	probably benign	0.00
R4478:Ptpn22	UTSW	3	103902064	intron	probably benign
R5093:Ptpn22	UTSW	3	103882102	missense	probably benign	0.39
R5579:Ptpn22	UTSW	3	103882139	splice site	probably null
R6022:Ptpn22	UTSW	3	103886105	missense	probably benign	0.00
R6110:Ptpn22	UTSW	3	103912015	missense	probably damaging	0.96
R6387:Ptpn22	UTSW	3	103885386	missense	probably benign	0.18
R7335:Ptpn22	UTSW	3	103886019	missense	probably damaging	0.97
R7516:Ptpn22	UTSW	3	103885538	missense	probably benign	0.16
R7523:Ptpn22	UTSW	3	103912015	missense	probably damaging	0.96
R7583:Ptpn22	UTSW	3	103902114	missense	probably benign	0.11
R8129:Ptpn22	UTSW	3	103890284	critical splice donor site	probably null
R8141:Ptpn22	UTSW	3	103886327	missense	possibly damaging	0.67
R9039:Ptpn22	UTSW	3	103912235	unclassified	probably benign
R9511:Ptpn22	UTSW	3	103885597	missense	probably benign	0.37
R9790:Ptpn22	UTSW	3	103888526	missense	possibly damaging	0.60
R9791:Ptpn22	UTSW	3	103888526	missense	possibly damaging	0.60
Z1177:Ptpn22	UTSW	3	103885700	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- GGCTCTTCCTGTATGTGATGCAC -3'
(R):5'- TCTAAGATTAAGAACAAGCGCTGGG -3'

Sequencing Primer
(F):5'- ACTGGCTCAGTCTTGCAAAG -3'
(R):5'- CAAGCGCTGGGTTAAAAACTG -3'

Posted On

2015-04-29