Incidental Mutation 'R3977:Lrig2'
ID311063
Institutional Source Beutler Lab
Gene Symbol Lrig2
Ensembl Gene ENSMUSG00000032913
Gene Nameleucine-rich repeats and immunoglobulin-like domains 2
Synonyms4632419I10Rik
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location104396418-104511918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104457844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 664 (V664E)
Ref Sequence ENSEMBL: ENSMUSP00000142373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046316] [ENSMUST00000198332] [ENSMUST00000199070]
Predicted Effect probably benign
Transcript: ENSMUST00000046316
AA Change: V1029E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000035999
Gene: ENSMUSG00000032913
AA Change: V1029E

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197018
Predicted Effect probably benign
Transcript: ENSMUST00000198332
AA Change: V1022E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142540
Gene: ENSMUSG00000032913
AA Change: V1022E

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199070
AA Change: V664E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142373
Gene: ENSMUSG00000032913
AA Change: V664E

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
LRRCT 84 134 1.8e-10 SMART
IG 145 240 9.2e-12 SMART
IGc2 255 323 8.1e-13 SMART
IGc2 349 414 1.3e-13 SMART
transmembrane domain 447 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200453
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing leucine-rich repeats and immunoglobulin-like domains. The encoded protein promotes epidermal growth factor signalling, resulting in increased proliferation. Its expression in the cytoplasm of glioma cells is correlated with poor survival. Mutations in this gene can cause urofacial syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to PDGFB-induced glioma and premature death due to illness with reduced body weight, letahrgy, hackled fur, crouched posture and increased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Lrig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Lrig2 APN 3 104467171 missense probably damaging 0.99
IGL00715:Lrig2 APN 3 104463948 missense probably damaging 1.00
IGL01105:Lrig2 APN 3 104464168 nonsense probably null
IGL01767:Lrig2 APN 3 104491545 missense probably benign 0.12
IGL02080:Lrig2 APN 3 104464124 missense probably damaging 1.00
IGL02088:Lrig2 APN 3 104467108 missense probably damaging 1.00
IGL02967:Lrig2 APN 3 104494196 intron probably benign
IGL03024:Lrig2 APN 3 104494073 missense probably damaging 1.00
IGL03079:Lrig2 APN 3 104490971 missense probably damaging 0.98
IGL03085:Lrig2 APN 3 104467259 missense probably damaging 1.00
IGL03162:Lrig2 APN 3 104464297 missense probably damaging 1.00
Belladonna UTSW 3 104467366 splice site probably benign
R0414:Lrig2 UTSW 3 104494056 critical splice donor site probably null
R0866:Lrig2 UTSW 3 104464275 missense probably benign 0.00
R1184:Lrig2 UTSW 3 104490911 missense possibly damaging 0.94
R1524:Lrig2 UTSW 3 104463876 missense probably benign 0.38
R1606:Lrig2 UTSW 3 104480107 critical splice donor site probably null
R1672:Lrig2 UTSW 3 104491812 missense probably damaging 1.00
R1701:Lrig2 UTSW 3 104494677 missense probably benign 0.02
R1778:Lrig2 UTSW 3 104467366 splice site probably benign
R2034:Lrig2 UTSW 3 104494092 missense probably benign
R2100:Lrig2 UTSW 3 104511630 missense possibly damaging 0.76
R2186:Lrig2 UTSW 3 104468598 missense probably benign 0.00
R3778:Lrig2 UTSW 3 104457961 missense probably benign
R4119:Lrig2 UTSW 3 104467195 missense probably benign 0.00
R4210:Lrig2 UTSW 3 104467304 missense probably benign 0.00
R4612:Lrig2 UTSW 3 104462783 missense probably damaging 1.00
R4872:Lrig2 UTSW 3 104491526 missense possibly damaging 0.66
R5020:Lrig2 UTSW 3 104457901 missense possibly damaging 0.71
R5499:Lrig2 UTSW 3 104461557 missense probably benign 0.00
R5687:Lrig2 UTSW 3 104464072 unclassified probably null
R5718:Lrig2 UTSW 3 104468615 nonsense probably null
R5886:Lrig2 UTSW 3 104462698 missense probably benign 0.01
R5921:Lrig2 UTSW 3 104462754 nonsense probably null
R6434:Lrig2 UTSW 3 104491547 missense possibly damaging 0.91
R6468:Lrig2 UTSW 3 104467193 missense probably damaging 1.00
R6513:Lrig2 UTSW 3 104465729 missense probably damaging 1.00
R6675:Lrig2 UTSW 3 104457935 missense probably benign 0.35
R7243:Lrig2 UTSW 3 104497567 splice site probably null
R7395:Lrig2 UTSW 3 104497520 missense probably benign 0.00
R7444:Lrig2 UTSW 3 104497513 nonsense probably null
R7514:Lrig2 UTSW 3 104465760 missense probably damaging 1.00
R7751:Lrig2 UTSW 3 104494669 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTACACTTCTGTCAGCCAC -3'
(R):5'- GTTGAAATTCCAGCTATCACTGATG -3'

Sequencing Primer
(F):5'- TTTGCCAGGTGTAAGCCCAAAC -3'
(R):5'- CCAGCTATCACTGATGATATTTCTTG -3'
Posted On2015-04-29