Incidental Mutation 'R3977:Smpd1'
ID311075
Institutional Source Beutler Lab
Gene Symbol Smpd1
Ensembl Gene ENSMUSG00000037049
Gene Namesphingomyelin phosphodiesterase 1, acid lysosomal
SynonymsASM, aSMase, A-SMase, acid sphingomyelinase, Zn-SMase
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105554360-105558389 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105555901 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 329 (F329S)
Ref Sequence ENSEMBL: ENSMUSP00000042187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046983] [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000187057] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601]
Predicted Effect probably benign
Transcript: ENSMUST00000046983
AA Change: F329S

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042187
Gene: ENSMUSG00000037049
AA Change: F329S

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
SapB 85 163 1.05e-7 SMART
low complexity region 177 196 N/A INTRINSIC
Pfam:Metallophos 197 459 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081165
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186814
Predicted Effect probably benign
Transcript: ENSMUST00000187057
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably benign
Transcript: ENSMUST00000188368
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189378
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191011
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191250
Predicted Effect probably benign
Transcript: ENSMUST00000191601
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211307
Predicted Effect probably benign
Transcript: ENSMUST00000211614
Meta Mutation Damage Score 0.1020 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]
PHENOTYPE: Nullizygous mutations cause tremors, ataxia, altered lipid homeostasis, increased foam cell number, Purkinje cell loss and premature death, and may lead to hepatosplenomegaly, hunched posture, reduced weight, abnormal apoptosis, sperm defects, dyspnea, and high susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Smpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Smpd1 APN 7 105556641 missense probably damaging 0.99
IGL01147:Smpd1 APN 7 105555736 missense probably damaging 1.00
IGL01526:Smpd1 APN 7 105554775 missense probably benign 0.01
IGL01541:Smpd1 APN 7 105555826 missense possibly damaging 0.48
IGL01619:Smpd1 APN 7 105555342 missense possibly damaging 0.89
IGL01924:Smpd1 APN 7 105555448 missense probably benign 0.01
IGL03004:Smpd1 APN 7 105556674 missense possibly damaging 0.82
R0782:Smpd1 UTSW 7 105555343 missense possibly damaging 0.80
R1445:Smpd1 UTSW 7 105556674 missense possibly damaging 0.82
R1489:Smpd1 UTSW 7 105556554 unclassified probably null
R3683:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R3685:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R4850:Smpd1 UTSW 7 105555985 missense probably benign
R5084:Smpd1 UTSW 7 105556978 missense probably damaging 1.00
R6316:Smpd1 UTSW 7 105555502 missense probably benign 0.19
R6429:Smpd1 UTSW 7 105556928 missense probably damaging 1.00
R6672:Smpd1 UTSW 7 105555273 missense probably benign
R7156:Smpd1 UTSW 7 105554486 unclassified probably benign
R7883:Smpd1 UTSW 7 105556985 missense probably damaging 1.00
R7966:Smpd1 UTSW 7 105556985 missense probably damaging 1.00
X0021:Smpd1 UTSW 7 105557645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGTTGAAAGGACTGGG -3'
(R):5'- GACACCTGCTGGAGTAGTCTAC -3'

Sequencing Primer
(F):5'- GCCGGCCCTTTTGAAATG -3'
(R):5'- GCTGGAGTAGTCTACCCAGTTC -3'
Posted On2015-04-29