Incidental Mutation 'R3977:Gprc6a'
ID311078
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 040940-MU
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51621101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 449 (V449L)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: V449L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: V449L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: V274L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
Meta Mutation Damage Score 0.1205 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTGCAAAACAGCCTAGGAC -3'
(R):5'- GGTGGGACTCTTTCTTAAACTGTTC -3'

Sequencing Primer
(F):5'- GGACAAAAATCACCTTAAGTTTCCTG -3'
(R):5'- AGTGTCTTCACGGGGATA -3'
Posted On2015-04-29