Incidental Mutation 'R3977:Sycp2l'
ID311087
Institutional Source Beutler Lab
Gene Symbol Sycp2l
Ensembl Gene ENSMUSG00000038651
Gene Namesynaptonemal complex protein 2-like
SynonymsEG621792, LOC218175
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location41114307-41174351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41141964 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 334 (I334M)
Ref Sequence ENSEMBL: ENSMUSP00000115127 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000124093
AA Change: I334M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit early reproductive senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Sycp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4531001:Sycp2l UTSW 13 41146672 missense probably null 0.00
R0016:Sycp2l UTSW 13 41157500 intron probably benign
R0024:Sycp2l UTSW 13 41141788 missense probably damaging 1.00
R0024:Sycp2l UTSW 13 41141788 missense probably damaging 1.00
R0099:Sycp2l UTSW 13 41129525 splice site probably benign
R0471:Sycp2l UTSW 13 41150530 splice site probably null
R0582:Sycp2l UTSW 13 41137955 splice site probably benign
R0605:Sycp2l UTSW 13 41143466 missense probably benign 0.22
R1311:Sycp2l UTSW 13 41135185 nonsense probably null
R1999:Sycp2l UTSW 13 41118304 missense probably benign 0.11
R3115:Sycp2l UTSW 13 41148798 missense probably benign 0.41
R3979:Sycp2l UTSW 13 41141964 missense probably damaging 0.99
R4643:Sycp2l UTSW 13 41143465 missense probably benign 0.01
R5027:Sycp2l UTSW 13 41129771 critical splice acceptor site probably null
R5037:Sycp2l UTSW 13 41129861 missense possibly damaging 0.89
R5780:Sycp2l UTSW 13 41129500 missense possibly damaging 0.61
R6216:Sycp2l UTSW 13 41141724 missense probably damaging 1.00
R7035:Sycp2l UTSW 13 41157497 missense unknown
R7179:Sycp2l UTSW 13 41129782 missense probably damaging 1.00
R7267:Sycp2l UTSW 13 41146594 missense possibly damaging 0.69
R7470:Sycp2l UTSW 13 41163104 missense probably benign 0.01
R7593:Sycp2l UTSW 13 41172716 missense probably damaging 1.00
R8030:Sycp2l UTSW 13 41172670 missense not run
R8218:Sycp2l UTSW 13 41118068 missense not run
Z1177:Sycp2l UTSW 13 41114364 unclassified probably benign
Z1177:Sycp2l UTSW 13 41146582 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CAGAGGTAACCAGGGTTCATTC -3'
(R):5'- TCAATTCCCATTCAGAGAAGCC -3'

Sequencing Primer
(F):5'- GGTTCATTCCCCAGCAGAC -3'
(R):5'- TCTGGACACATGGCTCAAAG -3'
Posted On2015-04-29