Incidental Mutation 'R3977:Adam28'
ID 311089
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Name a disintegrin and metallopeptidase domain 28
Synonyms MDC-L, D430033C21Rik, Dtgn1, C130072N01Rik
MMRRC Submission 040940-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R3977 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 68843476-68893291 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68848443 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 671 (V671A)
Ref Sequence ENSEMBL: ENSMUSP00000153354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
AlphaFold Q9JLN6
Predicted Effect probably benign
Transcript: ENSMUST00000022642
AA Change: V671A

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: V671A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111072
AA Change: V671A

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: V671A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224039
AA Change: V671A

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230006
Meta Mutation Damage Score 0.4071 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,872,664 (GRCm39) P942L possibly damaging Het
Arfgef1 A G 1: 10,279,859 (GRCm39) V236A probably benign Het
B020004C17Rik G T 14: 57,254,645 (GRCm39) M156I possibly damaging Het
Bicral T A 17: 47,141,917 (GRCm39) M1L unknown Het
Brpf3 A G 17: 29,026,016 (GRCm39) E363G possibly damaging Het
Ccdc96 T C 5: 36,642,510 (GRCm39) L172P possibly damaging Het
Cln3 G A 7: 126,179,308 (GRCm39) probably benign Het
Dnah7c T C 1: 46,668,071 (GRCm39) I1526T possibly damaging Het
Entr1 T A 2: 26,274,805 (GRCm39) N364I probably damaging Het
Fmo3 T G 1: 162,786,147 (GRCm39) E281A probably damaging Het
Frem2 A G 3: 53,559,491 (GRCm39) I1672T probably benign Het
Gbp2b A G 3: 142,309,470 (GRCm39) I194V probably benign Het
Gprc6a C A 10: 51,497,197 (GRCm39) V449L probably benign Het
Hk1 A G 10: 62,126,098 (GRCm39) V396A probably benign Het
Hoxc13 T C 15: 102,829,675 (GRCm39) V18A possibly damaging Het
Hr A G 14: 70,801,024 (GRCm39) T699A probably benign Het
Il19 A T 1: 130,863,770 (GRCm39) C74S probably damaging Het
Krt1c T C 15: 101,719,562 (GRCm39) T703A unknown Het
Lrig2 A T 3: 104,365,160 (GRCm39) V664E probably damaging Het
Lrrc37a T C 11: 103,348,430 (GRCm39) K2755R unknown Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mbtd1 A G 11: 93,796,001 (GRCm39) N13D probably benign Het
Mfsd4b5 T C 10: 39,850,704 (GRCm39) probably benign Het
Nras A G 3: 102,967,541 (GRCm39) I46V probably benign Het
Oasl1 C T 5: 115,070,957 (GRCm39) T274I probably damaging Het
Ogfod2 C A 5: 124,251,272 (GRCm39) probably null Het
Or10q3 C A 19: 11,847,869 (GRCm39) R237L possibly damaging Het
Or10v1 T A 19: 11,873,880 (GRCm39) F165Y probably damaging Het
Or11a4 T C 17: 37,536,049 (GRCm39) V11A probably benign Het
Or2w1b T A 13: 21,300,031 (GRCm39) H56Q probably benign Het
Or4c3 C A 2: 89,852,089 (GRCm39) G107V probably damaging Het
Or6c5 C T 10: 129,074,377 (GRCm39) R120C probably damaging Het
Pkmyt1 A G 17: 23,954,305 (GRCm39) M362V probably benign Het
Ppfia2 A G 10: 106,666,490 (GRCm39) T399A possibly damaging Het
Ppp1r12b A G 1: 134,693,713 (GRCm39) S983P probably benign Het
Ptpn22 A G 3: 103,780,957 (GRCm39) probably benign Het
Raph1 A T 1: 60,537,682 (GRCm39) D491E probably benign Het
Rc3h1 A G 1: 160,786,969 (GRCm39) probably null Het
Rtn4 T C 11: 29,643,819 (GRCm39) L5P probably benign Het
Slc23a4 C T 6: 34,930,723 (GRCm39) V400I probably benign Het
Slco1a5 A G 6: 142,204,698 (GRCm39) probably benign Het
Smpd1 T C 7: 105,205,108 (GRCm39) F329S probably benign Het
Sycp2l A G 13: 41,295,440 (GRCm39) I334M probably damaging Het
Tas2r103 A G 6: 133,013,280 (GRCm39) L262P probably benign Het
Ten1 G A 11: 116,107,771 (GRCm39) probably null Het
Tfap2d C G 1: 19,174,718 (GRCm39) S57C possibly damaging Het
Tnr A G 1: 159,719,593 (GRCm39) M957V probably benign Het
Trbv13-3 A G 6: 41,107,079 (GRCm39) probably benign Het
Trp53rkb C T 2: 166,637,446 (GRCm39) A134V possibly damaging Het
Trp63 A G 16: 25,639,490 (GRCm39) probably benign Het
Vmn2r112 T A 17: 22,822,096 (GRCm39) V258E probably damaging Het
Vmn2r74 T C 7: 85,607,345 (GRCm39) Y126C probably benign Het
Vmn2r96 T A 17: 18,817,941 (GRCm39) I698N probably damaging Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68,859,569 (GRCm39) missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68,886,877 (GRCm39) missense probably benign 0.00
IGL01021:Adam28 APN 14 68,879,563 (GRCm39) missense probably benign
IGL01099:Adam28 APN 14 68,874,778 (GRCm39) critical splice donor site probably null
IGL01349:Adam28 APN 14 68,848,455 (GRCm39) missense probably benign 0.01
IGL01744:Adam28 APN 14 68,844,956 (GRCm39) missense probably benign 0.07
IGL01805:Adam28 APN 14 68,879,540 (GRCm39) missense probably benign 0.09
IGL02007:Adam28 APN 14 68,870,668 (GRCm39) missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68,884,319 (GRCm39) missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68,874,883 (GRCm39) missense probably damaging 1.00
IGL03355:Adam28 APN 14 68,872,252 (GRCm39) splice site probably benign
IGL02980:Adam28 UTSW 14 68,857,255 (GRCm39) missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68,872,325 (GRCm39) missense probably benign 0.00
R0184:Adam28 UTSW 14 68,874,822 (GRCm39) missense probably benign 0.33
R0321:Adam28 UTSW 14 68,855,200 (GRCm39) missense probably damaging 0.97
R0329:Adam28 UTSW 14 68,855,188 (GRCm39) missense probably damaging 0.96
R0494:Adam28 UTSW 14 68,868,241 (GRCm39) splice site probably benign
R0605:Adam28 UTSW 14 68,844,049 (GRCm39) unclassified probably benign
R0732:Adam28 UTSW 14 68,874,796 (GRCm39) missense probably benign 0.00
R0959:Adam28 UTSW 14 68,845,387 (GRCm39) missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68,846,578 (GRCm39) missense probably benign 0.28
R1745:Adam28 UTSW 14 68,870,620 (GRCm39) missense probably benign 0.04
R1836:Adam28 UTSW 14 68,886,870 (GRCm39) missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68,876,659 (GRCm39) missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68,876,659 (GRCm39) missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68,876,644 (GRCm39) missense probably benign 0.01
R1912:Adam28 UTSW 14 68,881,780 (GRCm39) missense probably benign 0.24
R2830:Adam28 UTSW 14 68,864,363 (GRCm39) missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68,872,294 (GRCm39) missense possibly damaging 0.85
R3978:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R3979:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R4282:Adam28 UTSW 14 68,885,155 (GRCm39) missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68,859,531 (GRCm39) critical splice donor site probably null
R4690:Adam28 UTSW 14 68,879,497 (GRCm39) missense probably benign 0.01
R4724:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 0.99
R4768:Adam28 UTSW 14 68,872,264 (GRCm39) missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68,875,552 (GRCm39) missense probably damaging 0.99
R5054:Adam28 UTSW 14 68,855,164 (GRCm39) missense probably damaging 1.00
R5710:Adam28 UTSW 14 68,847,357 (GRCm39) missense probably damaging 0.96
R5835:Adam28 UTSW 14 68,893,130 (GRCm39) missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68,879,511 (GRCm39) missense probably benign
R6054:Adam28 UTSW 14 68,879,601 (GRCm39) missense probably benign 0.01
R6349:Adam28 UTSW 14 68,870,621 (GRCm39) missense probably benign 0.29
R6449:Adam28 UTSW 14 68,868,116 (GRCm39) missense probably benign 0.31
R6455:Adam28 UTSW 14 68,870,657 (GRCm39) missense probably damaging 1.00
R6831:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R6833:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R7212:Adam28 UTSW 14 68,874,846 (GRCm39) missense probably damaging 0.99
R7411:Adam28 UTSW 14 68,864,396 (GRCm39) missense probably damaging 1.00
R7422:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 1.00
R7516:Adam28 UTSW 14 68,868,125 (GRCm39) missense probably damaging 1.00
R7649:Adam28 UTSW 14 68,872,282 (GRCm39) missense probably benign 0.12
R7765:Adam28 UTSW 14 68,846,555 (GRCm39) critical splice donor site probably null
R8469:Adam28 UTSW 14 68,844,029 (GRCm39) missense probably benign 0.16
R8520:Adam28 UTSW 14 68,879,532 (GRCm39) missense probably damaging 0.98
R9026:Adam28 UTSW 14 68,846,593 (GRCm39) missense probably benign 0.16
R9163:Adam28 UTSW 14 68,866,531 (GRCm39) missense probably damaging 0.98
R9264:Adam28 UTSW 14 68,844,914 (GRCm39) missense probably benign
R9304:Adam28 UTSW 14 68,874,946 (GRCm39) missense probably damaging 1.00
R9357:Adam28 UTSW 14 68,879,479 (GRCm39) missense probably benign 0.36
R9441:Adam28 UTSW 14 68,874,943 (GRCm39) missense probably damaging 0.96
Z1177:Adam28 UTSW 14 68,864,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAGGATTAAGTCATAGACTCC -3'
(R):5'- TCCAGTGAGACAGGTTCATTTG -3'

Sequencing Primer
(F):5'- CTCCAATGTCAGATGAAGTAGATGAC -3'
(R):5'- TAAGGCTATCCTGGGCTACATGAC -3'
Posted On 2015-04-29