Incidental Mutation 'R3977:Hoxc13'
ID311092
Institutional Source Beutler Lab
Gene Symbol Hoxc13
Ensembl Gene ENSMUSG00000001655
Gene Namehomeobox C13
Synonyms
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3977 (G1)
Quality Score113
Status Validated
Chromosome15
Chromosomal Location102921103-102928814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102921240 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 18 (V18A)
Ref Sequence ENSEMBL: ENSMUSP00000001700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001700
AA Change: V18A

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001700
Gene: ENSMUSG00000001655
AA Change: V18A

DomainStartEndE-ValueType
low complexity region 22 50 N/A INTRINSIC
Pfam:HoxA13_N 52 166 1.7e-38 PFAM
HOX 258 320 6.12e-22 SMART
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. The product of this gene may play a role in the development of hair, nail, and filiform papilla. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit alopecia due to brittle hair, poor growth, abnormalities of caudal vertebrae, nails, and tongue filiform papillae, and lethality in the second week. Rare survivors recover, but lack hair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Hoxc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02563:Hoxc13 APN 15 102921798 missense possibly damaging 0.76
R2125:Hoxc13 UTSW 15 102927223 missense probably damaging 1.00
R3741:Hoxc13 UTSW 15 102921438 missense possibly damaging 0.84
R3742:Hoxc13 UTSW 15 102921438 missense possibly damaging 0.84
R3978:Hoxc13 UTSW 15 102921240 missense possibly damaging 0.60
R6820:Hoxc13 UTSW 15 102921822 missense probably damaging 1.00
R7127:Hoxc13 UTSW 15 102921468 missense possibly damaging 0.87
R7719:Hoxc13 UTSW 15 102921858 missense possibly damaging 0.77
R8204:Hoxc13 UTSW 15 102927360 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAGTGTGTCCGCATGC -3'
(R):5'- TCTGCTGCAGGTTCACGTTG -3'

Sequencing Primer
(F):5'- CCGCATGCGTAGTGGGAATG -3'
(R):5'- TAGTAGCTGCCCCCAAATGG -3'
Posted On2015-04-29