Incidental Mutation 'R3977:Olfr96'
ID311097
Institutional Source Beutler Lab
Gene Symbol Olfr96
Ensembl Gene ENSMUSG00000064121
Gene Nameolfactory receptor 96
SynonymsGA_x6K02T2PSCP-1665046-1665987, MOR121-1
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37220146-37226673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37225158 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 11 (V11A)
Ref Sequence ENSEMBL: ENSMUSP00000151151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078209] [ENSMUST00000213475] [ENSMUST00000214482]
Predicted Effect probably benign
Transcript: ENSMUST00000078209
AA Change: V11A

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077338
Gene: ENSMUSG00000064121
AA Change: V11A

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.6e-53 PFAM
Pfam:7tm_1 43 291 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213475
AA Change: V11A

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000214482
AA Change: V11A

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr1420 T A 19: 11,896,516 F165Y probably damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Olfr96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Olfr96 APN 17 37225152 missense probably benign 0.05
IGL02151:Olfr96 APN 17 37225166 missense probably damaging 1.00
IGL02335:Olfr96 APN 17 37225326 missense probably damaging 0.97
R0360:Olfr96 UTSW 17 37226043 missense possibly damaging 0.49
R0364:Olfr96 UTSW 17 37226043 missense possibly damaging 0.49
R1763:Olfr96 UTSW 17 37225430 missense probably benign 0.02
R6116:Olfr96 UTSW 17 37225568 missense probably benign 0.00
R6248:Olfr96 UTSW 17 37225560 nonsense probably null
R6378:Olfr96 UTSW 17 37225797 missense probably benign 0.21
R6518:Olfr96 UTSW 17 37225268 missense probably benign 0.05
R6614:Olfr96 UTSW 17 37225899 missense probably benign 0.01
R6798:Olfr96 UTSW 17 37225806 missense probably damaging 1.00
R6874:Olfr96 UTSW 17 37225347 missense probably benign 0.00
R7468:Olfr96 UTSW 17 37225385 missense probably benign 0.01
R7820:Olfr96 UTSW 17 37225895 missense probably benign 0.00
R7852:Olfr96 UTSW 17 37225272 missense probably benign 0.01
R7935:Olfr96 UTSW 17 37225272 missense probably benign 0.01
X0027:Olfr96 UTSW 17 37225743 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCCTAGGCCATTAGGAGTATGC -3'
(R):5'- TCTCTATGAAGGACAGATTCACCAG -3'

Sequencing Primer
(F):5'- GCCATTAGGAGTATGCTACCTTAAAG -3'
(R):5'- TTCACCAGAAAGAAATACATGGGTG -3'
Posted On2015-04-29