Incidental Mutation 'R3977:Olfr1420'
ID311100
Institutional Source Beutler Lab
Gene Symbol Olfr1420
Ensembl Gene ENSMUSG00000060878
Gene Nameolfactory receptor 1420
SynonymsMOR266-4, GA_x6K02T2RE5P-2247227-2248156
MMRRC Submission 040940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R3977 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11886565-11898079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11896516 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 165 (F165Y)
Ref Sequence ENSEMBL: ENSMUSP00000149208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072784] [ENSMUST00000217281]
Predicted Effect probably damaging
Transcript: ENSMUST00000072784
AA Change: F165Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072563
Gene: ENSMUSG00000060878
AA Change: F165Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-54 PFAM
Pfam:7tm_1 41 291 3.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215766
Predicted Effect probably damaging
Transcript: ENSMUST00000217281
AA Change: F165Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3287 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,981,838 P942L possibly damaging Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Brpf3 A G 17: 28,807,042 E363G possibly damaging Het
Ccdc96 T C 5: 36,485,166 L172P possibly damaging Het
Cln3 G A 7: 126,580,136 probably benign Het
Dnah7c T C 1: 46,628,911 I1526T possibly damaging Het
Fmo3 T G 1: 162,958,578 E281A probably damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gbp2b A G 3: 142,603,709 I194V probably benign Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hk1 A G 10: 62,290,319 V396A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il19 A T 1: 130,936,033 C74S probably damaging Het
Krt2 T C 15: 101,811,127 T703A unknown Het
Lrig2 A T 3: 104,457,844 V664E probably damaging Het
Lrrc37a T C 11: 103,457,604 K2755R unknown Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mbtd1 A G 11: 93,905,175 N13D probably benign Het
Mfsd4b5 T C 10: 39,974,708 probably benign Het
Nras A G 3: 103,060,225 I46V probably benign Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Ogfod2 C A 5: 124,113,209 probably null Het
Olfr1264 C A 2: 90,021,745 G107V probably damaging Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Olfr1419 C A 19: 11,870,505 R237L possibly damaging Het
Olfr774 C T 10: 129,238,508 R120C probably damaging Het
Olfr96 T C 17: 37,225,158 V11A probably benign Het
Pkmyt1 A G 17: 23,735,331 M362V probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1r12b A G 1: 134,765,975 S983P probably benign Het
Ptpn22 A G 3: 103,873,641 probably benign Het
Raph1 A T 1: 60,498,523 D491E probably benign Het
Rc3h1 A G 1: 160,959,399 probably null Het
Rtn4 T C 11: 29,693,819 L5P probably benign Het
Sdccag3 T A 2: 26,384,793 N364I probably damaging Het
Slc23a4 C T 6: 34,953,788 V400I probably benign Het
Slco1a5 A G 6: 142,258,972 probably benign Het
Smpd1 T C 7: 105,555,901 F329S probably benign Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Ten1 G A 11: 116,216,945 probably null Het
Tfap2d C G 1: 19,104,494 S57C possibly damaging Het
Tnr A G 1: 159,892,023 M957V probably benign Het
Trbv13-3 A G 6: 41,130,145 probably benign Het
Trp53rkb C T 2: 166,795,526 A134V possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r74 T C 7: 85,958,137 Y126C probably benign Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Other mutations in Olfr1420
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Olfr1420 APN 19 11896822 missense probably benign 0.06
IGL02703:Olfr1420 APN 19 11896242 missense possibly damaging 0.96
IGL02948:Olfr1420 APN 19 11896781 nonsense probably null
R1514:Olfr1420 UTSW 19 11896614 missense probably benign
R1539:Olfr1420 UTSW 19 11896491 missense possibly damaging 0.88
R1852:Olfr1420 UTSW 19 11896885 missense probably damaging 1.00
R1903:Olfr1420 UTSW 19 11896549 missense probably benign 0.24
R2061:Olfr1420 UTSW 19 11896557 missense probably damaging 0.98
R3768:Olfr1420 UTSW 19 11896312 missense probably damaging 0.99
R4479:Olfr1420 UTSW 19 11896558 missense probably damaging 0.99
R4592:Olfr1420 UTSW 19 11896762 missense probably benign
R5934:Olfr1420 UTSW 19 11896929 missense probably benign
R6058:Olfr1420 UTSW 19 11896024 start codon destroyed probably null 1.00
R6536:Olfr1420 UTSW 19 11896396 missense probably benign 0.05
R7752:Olfr1420 UTSW 19 11896534 missense probably benign 0.01
R7901:Olfr1420 UTSW 19 11896534 missense probably benign 0.01
R8250:Olfr1420 UTSW 19 11896377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGGTTGTGGTACCCAG -3'
(R):5'- TCCGTAAAATCGCTGTGATGATG -3'

Sequencing Primer
(F):5'- CTGGTTGTGGTACCCAGATGTTTTTC -3'
(R):5'- TCGCTGTGATGATGAAGACATAG -3'
Posted On2015-04-29