Incidental Mutation 'R3978:Vmn2r68'
ID311123
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Namevomeronasal 2, receptor 68
SynonymsVmn2r68-ps, EG620697
MMRRC Submission 040941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3978 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85221518-85237704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85232462 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 470 (Y470F)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
Predicted Effect probably benign
Transcript: ENSMUST00000061074
AA Change: Y470F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: Y470F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,183,674 T61A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Ano5 G A 7: 51,587,806 V743I probably benign Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arid2 A G 15: 96,363,622 D453G probably damaging Het
Atp2b1 C A 10: 98,996,933 probably null Het
Azin1 A T 15: 38,498,713 N135K probably damaging Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Cfap54 T C 10: 92,962,412 T1662A probably benign Het
Cog8 T A 8: 107,053,037 I203F probably damaging Het
Col6a6 T C 9: 105,698,879 H2094R probably damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dpyd AAAT AAATGTATATAAAT 3: 118,897,088 probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Eif3i T C 4: 129,592,336 E276G probably damaging Het
Fam171a1 A C 2: 3,225,035 M402L probably benign Het
Fga A T 3: 83,030,183 probably null Het
Foxp2 A G 6: 15,197,208 probably benign Het
Gbp2 C T 3: 142,629,986 T149I possibly damaging Het
Gm9631 A G 11: 121,943,568 Y281H possibly damaging Het
Gpr21 C T 2: 37,517,850 T136I probably benign Het
Gprc5b C T 7: 118,984,131 V172M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
Hdlbp T C 1: 93,421,351 I535V probably damaging Het
Helb A G 10: 120,089,625 V949A probably benign Het
Hoxc13 T C 15: 102,921,240 V18A possibly damaging Het
Hr A G 14: 70,563,584 T699A probably benign Het
Il27ra G A 8: 84,040,684 T170I probably benign Het
Insm2 T C 12: 55,600,838 Y456H probably benign Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Lin9 T A 1: 180,668,792 I298N possibly damaging Het
Lyst G A 13: 13,634,168 R141Q possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr485 A G 7: 108,159,612 M87T possibly damaging Het
Pdgfrb A T 18: 61,073,685 H661L probably damaging Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Ppp1ca T C 19: 4,192,254 I13T probably benign Het
Psmd1 T C 1: 86,128,187 M757T probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rfx7 A G 9: 72,615,111 T296A possibly damaging Het
Rgl2 G A 17: 33,935,162 R472H probably benign Het
Rhcg T C 7: 79,617,399 E43G probably benign Het
Rif1 T A 2: 52,116,747 probably null Het
Rorb A G 19: 18,937,890 V468A probably benign Het
Rxrb C T 17: 34,036,326 P209L possibly damaging Het
Sbf2 G T 7: 110,329,885 T1438K probably benign Het
Setd3 A T 12: 108,157,942 C163S possibly damaging Het
Slc15a1 C T 14: 121,489,827 D110N probably benign Het
Slc26a3 T A 12: 31,465,860 probably null Het
Slc5a5 A G 8: 70,889,395 V305A probably benign Het
Slc6a6 A T 6: 91,755,052 M621L probably benign Het
Smgc A T 15: 91,860,348 D301V probably damaging Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Syt15 T A 14: 34,223,104 C203S probably benign Het
Tdrd1 A G 19: 56,866,634 R1171G probably benign Het
Trp63 A G 16: 25,820,740 probably benign Het
Tspan9 A G 6: 127,967,247 V30A probably damaging Het
Ubp1 A T 9: 113,956,705 probably null Het
Wbp1l T A 19: 46,653,957 probably null Het
Wee1 G T 7: 110,124,555 D226Y probably damaging Het
Yap1 C T 9: 8,004,284 G36D probably damaging Het
Zmym6 T C 4: 127,123,555 I951T possibly damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAAAAGCGGTGGATATTTTC -3'
(R):5'- GTGTAACTACCTTTACATCCACGTG -3'

Sequencing Primer
(F):5'- TCATTAATTGTGCTACGGTTAAGC -3'
(R):5'- TACTTTCTGTTCTAATGTGGAAGCC -3'
Posted On2015-04-29