Incidental Mutation 'R3979:Abcb11'
ID311167
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission 040942-MU
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R3979 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69323976 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 82 (V82A)
Ref Sequence ENSEMBL: ENSMUSP00000099771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably benign
Transcript: ENSMUST00000102709
AA Change: V82A

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: V82A

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102710
AA Change: V82A

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: V82A

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180142
AA Change: V82A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: V82A

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ak3 T A 19: 29,047,718 S38C probably damaging Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arhgap10 T C 8: 77,420,725 N170S probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cachd1 A T 4: 100,970,888 D611V probably damaging Het
Cfap70 T A 14: 20,439,719 E246D probably benign Het
Chl1 T A 6: 103,715,284 Y294* probably null Het
Chrna2 T A 14: 66,148,953 Y183N probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dnajb6 T C 5: 29,751,008 F46L possibly damaging Het
Exoc7 T C 11: 116,296,762 E275G probably benign Het
Fam208a T C 14: 27,477,130 L1335S possibly damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gm12166 T A 11: 46,052,026 K90M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
H2-M10.4 A G 17: 36,461,985 V35A probably benign Het
Hr A G 14: 70,563,584 T699A probably benign Het
Iffo1 A G 6: 125,160,589 probably benign Het
Iqgap1 G A 7: 80,759,934 H218Y probably damaging Het
Itpr3 A C 17: 27,085,131 K109Q probably benign Het
Itpr3 A G 17: 27,091,572 D443G probably damaging Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Klk1b4 G A 7: 44,211,593 G220D probably damaging Het
Krt24 A G 11: 99,282,770 C242R probably benign Het
Madd G A 2: 91,176,828 T313I possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Micalcl A G 7: 112,407,678 probably null Het
Neil3 T C 8: 53,623,664 T79A probably damaging Het
Nras A G 3: 103,060,225 I46V probably benign Het
Olfr1196 T C 2: 88,700,448 S294G probably benign Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Rarres1 A G 3: 67,495,810 V86A probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rock2 A G 12: 16,972,736 K1059E probably damaging Het
Sparcl1 T C 5: 104,092,781 H259R probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Stab2 T C 10: 86,863,456 D515G possibly damaging Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tcaf2 A G 6: 42,642,547 V182A probably damaging Het
Tcof1 C T 18: 60,831,533 E674K possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Ttn A T 2: 76,745,394 W25052R probably damaging Het
Ubr1 T A 2: 120,862,687 N1746I probably benign Het
Vax2 T C 6: 83,737,547 V148A probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Wdr90 A G 17: 25,859,278 V372A probably benign Het
Zfp335 C T 2: 164,910,638 G62D probably benign Het
Zfp563 G A 17: 33,105,727 R432H probably benign Het
Zhx1 T C 15: 58,053,240 T537A probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7937:Abcb11 UTSW 2 69323873 small deletion probably benign
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69274039 missense probably benign 0.09
R8279:Abcb11 UTSW 2 69239205 missense probably benign 0.05
R8426:Abcb11 UTSW 2 69325262 missense probably benign
R8441:Abcb11 UTSW 2 69257230 missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69324037 missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69274155 missense probably benign
R8532:Abcb11 UTSW 2 69259691 missense possibly damaging 0.69
R8534:Abcb11 UTSW 2 69323846 missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69265512 missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69257410 intron probably benign
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAACTCAGTCGGTATTGTCTTTGG -3'
(R):5'- GTGAAATTAAATAGCCCTCCTGCC -3'

Sequencing Primer
(F):5'- AGTCGGTATTGTCTTTGGATGTTTTG -3'
(R):5'- ATTAAATAGCCCTCCTGCCCATCC -3'
Posted On2015-04-29