Incidental Mutation 'R0383:Uggt2'
ID31118
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene NameUDP-glucose glycoprotein glucosyltransferase 2
Synonyms3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik
MMRRC Submission 038589-MU
Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R0383 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location118985039-119099430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119049451 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 661 (F661I)
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]
Predicted Effect probably damaging
Transcript: ENSMUST00000127153
AA Change: F185I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104
AA Change: F185I

DomainStartEndE-ValueType
low complexity region 327 334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138923
Predicted Effect probably damaging
Transcript: ENSMUST00000156203
AA Change: F661I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: F661I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,239,539 M537V probably benign Het
5730455P16Rik G T 11: 80,363,941 Y351* probably null Het
A530099J19Rik A G 13: 19,729,147 noncoding transcript Het
Aadac G T 3: 60,035,947 R91L possibly damaging Het
Adgrg1 T A 8: 95,011,742 F621Y probably damaging Het
Ankmy1 G T 1: 92,885,053 D511E probably benign Het
Anks4b A T 7: 120,182,874 D376V probably damaging Het
Aox1 G T 1: 58,061,241 C399F probably benign Het
Arfgef1 C T 1: 10,198,842 probably null Het
Arhgef4 G A 1: 34,810,533 V546M probably damaging Het
Cab39 T A 1: 85,837,299 V98E probably damaging Het
Cacna1b T C 2: 24,761,844 N108D probably damaging Het
Car15 C A 16: 17,836,753 E134* probably null Het
Ccdc80 T G 16: 45,095,369 Y163D probably damaging Het
Col22a1 C T 15: 71,869,004 G513D unknown Het
Col8a1 T C 16: 57,632,442 D66G probably damaging Het
Crot C A 5: 8,968,734 S544I probably damaging Het
Cubn G T 2: 13,430,959 P1062Q probably damaging Het
Dcc A T 18: 71,420,263 V774E probably damaging Het
Dlgap5 T A 14: 47,410,361 M240L probably benign Het
Dlx4 A G 11: 95,145,435 V16A probably benign Het
Dnah17 G T 11: 118,067,547 H2703Q probably benign Het
Duox2 A G 2: 122,291,810 probably null Het
Fn1 C T 1: 71,597,685 V168I probably damaging Het
Fpr-rs4 A T 17: 18,022,097 D122V probably damaging Het
Gas2l2 A T 11: 83,423,097 I463N probably benign Het
Ggta1 G T 2: 35,402,404 P297Q probably damaging Het
Gpatch3 C A 4: 133,578,146 R231S probably damaging Het
Gpc1 T C 1: 92,854,983 Y151H probably damaging Het
Gtf2e2 T C 8: 33,755,945 W119R probably damaging Het
H2-M10.2 T C 17: 36,284,361 I304V probably benign Het
Helq T C 5: 100,779,165 K685R probably benign Het
Hps5 C T 7: 46,769,288 probably null Het
Iars T C 13: 49,732,342 C1186R probably damaging Het
Ift43 T C 12: 86,162,021 V158A possibly damaging Het
Iqca A T 1: 90,142,707 I141N probably damaging Het
Kat6b A G 14: 21,669,081 N1276S probably benign Het
Kif19a A T 11: 114,765,514 M1L possibly damaging Het
Kif1b T G 4: 149,202,512 H1241P probably damaging Het
Kif26a T C 12: 112,178,076 V1588A possibly damaging Het
Klb T A 5: 65,372,499 probably null Het
Krtap26-1 A T 16: 88,647,243 Y163* probably null Het
Lefty1 G T 1: 180,937,634 E256* probably null Het
Lox T C 18: 52,529,199 N44S possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mctp1 A G 13: 76,801,544 Y565C probably damaging Het
Megf6 C T 4: 154,265,326 A961V probably benign Het
Mindy4 A G 6: 55,276,634 K496R probably benign Het
Nalcn A T 14: 123,507,559 H352Q probably benign Het
Ncoa5 T C 2: 165,009,390 I188V possibly damaging Het
Notum G T 11: 120,654,456 H426N probably benign Het
Olfr569 T A 7: 102,887,251 I301F possibly damaging Het
Orm2 A T 4: 63,363,996 D137V probably damaging Het
Pabpc2 G A 18: 39,775,395 G571D probably damaging Het
Pabpc4 A G 4: 123,297,942 N599S probably damaging Het
Pak1ip1 T C 13: 41,012,604 V335A probably benign Het
Pcdhb11 A C 18: 37,423,393 D592A probably damaging Het
Pmch C A 10: 88,091,258 T41K possibly damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Pter G T 2: 13,000,942 G309* probably null Het
Ptprg T C 14: 12,219,024 V406A possibly damaging Het
Ranbp3l A T 15: 9,063,104 E467V possibly damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Ripk4 C T 16: 97,748,112 C248Y probably damaging Het
Slc6a15 T C 10: 103,418,053 W617R probably damaging Het
Smyd5 C T 6: 85,440,173 Q178* probably null Het
St18 T A 1: 6,803,024 F328I probably damaging Het
Supt20 T A 3: 54,703,149 L124* probably null Het
Tarbp1 T A 8: 126,447,484 H861L probably benign Het
Tars A G 15: 11,390,325 M356T probably benign Het
Tbc1d10a A G 11: 4,212,819 T221A probably damaging Het
Tead3 A G 17: 28,334,698 probably null Het
Tprg A G 16: 25,422,235 T254A probably damaging Het
Trank1 C A 9: 111,391,477 N2427K probably benign Het
Ttc30b A G 2: 75,938,242 Y56H probably damaging Het
Tufm T C 7: 126,489,864 S380P probably damaging Het
Tyrobp C T 7: 30,414,617 R68C probably damaging Het
Ubl4b T C 3: 107,554,827 E39G possibly damaging Het
Upf3b A G X: 37,104,467 I144T probably benign Het
Usp54 A T 14: 20,561,252 D1165E probably benign Het
Vmn2r81 C T 10: 79,293,447 T724I possibly damaging Het
Vsig1 A G X: 140,936,313 I247M possibly damaging Het
Zfp110 C A 7: 12,849,260 L612I probably benign Het
Zfp318 C A 17: 46,413,296 T2075K probably damaging Het
Zfp37 A G 4: 62,191,885 M1T probably null Het
Zfp605 T A 5: 110,128,854 C613S probably damaging Het
Zfp729a G A 13: 67,621,673 P146S possibly damaging Het
Zfp85 T C 13: 67,748,672 N427S probably benign Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119049276 missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119026429 nonsense probably null
IGL00433:Uggt2 APN 14 119013487 missense probably benign
IGL00572:Uggt2 APN 14 119042791 missense probably benign 0.02
IGL00577:Uggt2 APN 14 119034900 missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119042799 missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119057645 missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119042772 missense probably benign 0.00
IGL01787:Uggt2 APN 14 119081734 missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119089193 missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119090738 missense probably benign 0.17
IGL02894:Uggt2 APN 14 119081799 missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119075346 missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119095310 missense probably benign 0.25
IGL03142:Uggt2 APN 14 118998191 missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119077668 missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119070888 missense probably benign 0.38
P0014:Uggt2 UTSW 14 119044538 missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119049663 missense probably benign 0.07
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0433:Uggt2 UTSW 14 119075329 critical splice donor site probably null
R0472:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119057598 missense probably benign 0.27
R0788:Uggt2 UTSW 14 119095400 splice site probably benign
R0940:Uggt2 UTSW 14 119091192 critical splice donor site probably null
R1567:Uggt2 UTSW 14 119009093 missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119057663 missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119054643 missense probably benign 0.19
R1746:Uggt2 UTSW 14 119013503 missense probably benign 0.00
R1785:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119032276 missense probably benign 0.00
R1894:Uggt2 UTSW 14 119049718 missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119008055 splice site probably benign
R2149:Uggt2 UTSW 14 119075345 missense probably benign 0.02
R2168:Uggt2 UTSW 14 119019505 missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2240:Uggt2 UTSW 14 118995049 missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119026599 missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119059109 missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2907:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2908:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2998:Uggt2 UTSW 14 119049385 missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119091270 missense probably benign 0.39
R3722:Uggt2 UTSW 14 119041518 missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119057672 missense probably benign 0.13
R4015:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119049262 missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119019558 missense probably benign
R4642:Uggt2 UTSW 14 119034935 missense probably benign 0.00
R4654:Uggt2 UTSW 14 119032258 missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119029054 splice site probably null
R4810:Uggt2 UTSW 14 119013521 missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119001847 missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119035964 splice site probably null
R4886:Uggt2 UTSW 14 119035964 splice site probably null
R4888:Uggt2 UTSW 14 119049253 missense probably damaging 1.00
R4888:Uggt2 UTSW 14 119077650 critical splice donor site probably null
R4895:Uggt2 UTSW 14 119018886 missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119081770 missense probably benign 0.00
R5423:Uggt2 UTSW 14 119019486 missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119090709 missense probably benign 0.01
R5561:Uggt2 UTSW 14 119041527 missense probably benign 0.02
R5607:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119077724 missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119042726 missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119049426 missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6056:Uggt2 UTSW 14 119035969 critical splice donor site probably null
R6289:Uggt2 UTSW 14 119041602 missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119057564 missense probably benign 0.01
R6515:Uggt2 UTSW 14 119077719 missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119070881 missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119042610 missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119026435 missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119001859 missense probably benign 0.10
R7117:Uggt2 UTSW 14 119014526 missense probably benign 0.25
R7183:Uggt2 UTSW 14 119019637 splice site probably null
R7337:Uggt2 UTSW 14 119086175 missense probably benign 0.28
R7342:Uggt2 UTSW 14 118994972 missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119089269 missense probably benign 0.12
R7625:Uggt2 UTSW 14 119026493 missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119075347 missense probably damaging 1.00
R7842:Uggt2 UTSW 14 118998104 missense probably damaging 1.00
R7891:Uggt2 UTSW 14 119042647 missense probably benign 0.09
R7925:Uggt2 UTSW 14 118998104 missense probably damaging 1.00
R7974:Uggt2 UTSW 14 119042647 missense probably benign 0.09
R8050:Uggt2 UTSW 14 119026422 missense probably damaging 0.98
Z1177:Uggt2 UTSW 14 119007296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGCTTTGCTATGACAGCACTC -3'
(R):5'- TGAAGAACTGAAAGGGGCTGTTCTG -3'

Sequencing Primer
(F):5'- GACAGCACTCTTATCTTGTGAATC -3'
(R):5'- AAAATGGTGGGCACATTTGTGG -3'
Posted On2013-04-24