Incidental Mutation 'R3979:Vax2'
ID311183
Institutional Source Beutler Lab
Gene Symbol Vax2
Ensembl Gene ENSMUSG00000034777
Gene Nameventral anterior homeobox 2
Synonyms
MMRRC Submission 040942-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R3979 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83711264-83738313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83737547 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000035976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037807]
Predicted Effect probably damaging
Transcript: ENSMUST00000037807
AA Change: V148A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035976
Gene: ENSMUSG00000034777
AA Change: V148A

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
HOX 102 164 3.54e-27 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 233 247 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox protein and is almost exclusively expressed in the ventral portion of the retina during development. In mouse studies, this gene was found to be required for the correct formation of the optic fissure and other aspects of retinal development. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null mutants for one allele show incomplete closure of optic fissure leading to coloboma, the frequency of which is strongly influenced by genetic background. Homozygous null mutants for 2 different alleles have abnormal projections of ventralretinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,323,976 V82A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ak3 T A 19: 29,047,718 S38C probably damaging Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arhgap10 T C 8: 77,420,725 N170S probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cachd1 A T 4: 100,970,888 D611V probably damaging Het
Cfap70 T A 14: 20,439,719 E246D probably benign Het
Chl1 T A 6: 103,715,284 Y294* probably null Het
Chrna2 T A 14: 66,148,953 Y183N probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dnajb6 T C 5: 29,751,008 F46L possibly damaging Het
Exoc7 T C 11: 116,296,762 E275G probably benign Het
Fam208a T C 14: 27,477,130 L1335S possibly damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gm12166 T A 11: 46,052,026 K90M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
H2-M10.4 A G 17: 36,461,985 V35A probably benign Het
Hr A G 14: 70,563,584 T699A probably benign Het
Iffo1 A G 6: 125,160,589 probably benign Het
Iqgap1 G A 7: 80,759,934 H218Y probably damaging Het
Itpr3 A C 17: 27,085,131 K109Q probably benign Het
Itpr3 A G 17: 27,091,572 D443G probably damaging Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Klk1b4 G A 7: 44,211,593 G220D probably damaging Het
Krt24 A G 11: 99,282,770 C242R probably benign Het
Madd G A 2: 91,176,828 T313I possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Micalcl A G 7: 112,407,678 probably null Het
Neil3 T C 8: 53,623,664 T79A probably damaging Het
Nras A G 3: 103,060,225 I46V probably benign Het
Olfr1196 T C 2: 88,700,448 S294G probably benign Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Rarres1 A G 3: 67,495,810 V86A probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rock2 A G 12: 16,972,736 K1059E probably damaging Het
Sparcl1 T C 5: 104,092,781 H259R probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Stab2 T C 10: 86,863,456 D515G possibly damaging Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tcaf2 A G 6: 42,642,547 V182A probably damaging Het
Tcof1 C T 18: 60,831,533 E674K possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Ttn A T 2: 76,745,394 W25052R probably damaging Het
Ubr1 T A 2: 120,862,687 N1746I probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Wdr90 A G 17: 25,859,278 V372A probably benign Het
Zfp335 C T 2: 164,910,638 G62D probably benign Het
Zfp563 G A 17: 33,105,727 R432H probably benign Het
Zhx1 T C 15: 58,053,240 T537A probably benign Het
Other mutations in Vax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Vax2 APN 6 83711537 missense possibly damaging 0.70
IGL02161:Vax2 APN 6 83737903 missense probably damaging 1.00
IGL02584:Vax2 APN 6 83711513 missense probably benign
R0316:Vax2 UTSW 6 83711444 missense possibly damaging 0.79
R0456:Vax2 UTSW 6 83711406 missense probably benign 0.00
R1006:Vax2 UTSW 6 83737777 missense probably damaging 1.00
R2045:Vax2 UTSW 6 83711270 start gained probably benign
R2217:Vax2 UTSW 6 83737889 missense probably damaging 0.98
R2324:Vax2 UTSW 6 83711325 missense possibly damaging 0.53
R4755:Vax2 UTSW 6 83711397 missense probably damaging 0.99
R7203:Vax2 UTSW 6 83737900 missense probably damaging 0.99
R7242:Vax2 UTSW 6 83711316 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CTGGTGTGAGAGGACACTAAC -3'
(R):5'- TTTCTGGGGTCAACCAAGG -3'

Sequencing Primer
(F):5'- TGTGAGAGGACACTAACAATCTGCTC -3'
(R):5'- AAGGAGGTGCCCCTGTG -3'
Posted On2015-04-29