Mutagenetix > Incidental Mutation

Incidental Mutation 'R3979:Chl1'

311185

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

MMRRC Submission

040942-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.482) question?

Stock #

R3979 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 103715284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 294 (Y294*)

Ref Sequence

ENSEMBL: ENSMUSP00000144739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]

AlphaFold

P70232

Predicted Effect

probably null
Transcript: ENSMUST00000066905
AA Change: Y1075*

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: Y1075*

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000203830
AA Change: Y1075*

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: Y1075*

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000203912
AA Change: Y1037*

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: Y1037*

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000205098
AA Change: Y294*

SMART Domains

Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077
AA Change: Y294*

Domain	Start	End	E-Value	Type
FN3	4	67	4.4e-1	SMART
FN3	83	174	1.2e-3	SMART
FN3	189	275	2.1e-9	SMART
transmembrane domain	301	323	N/A	INTRINSIC
Pfam:Bravo_FIGEY	324	409	3.6e-30	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,323,976	V82A	probably benign	Het
Adam28	A	G	14: 68,610,994	V671A	probably benign	Het
Ak3	T	A	19: 29,047,718	S38C	probably damaging	Het
Arfgef1	A	G	1: 10,209,634	V236A	probably benign	Het
Arhgap10	T	C	8: 77,420,725	N170S	probably benign	Het
B020004C17Rik	G	T	14: 57,017,188	M156I	possibly damaging	Het
Bicral	T	A	17: 46,830,991	M1L	unknown	Het
Bop1	A	G	15: 76,453,876	L598P	probably damaging	Het
Cachd1	A	T	4: 100,970,888	D611V	probably damaging	Het
Cfap70	T	A	14: 20,439,719	E246D	probably benign	Het
Chrna2	T	A	14: 66,148,953	Y183N	probably damaging	Het
Dab2	A	G	15: 6,435,163		probably null	Het
Dnajb6	T	C	5: 29,751,008	F46L	possibly damaging	Het
Exoc7	T	C	11: 116,296,762	E275G	probably benign	Het
Fam208a	T	C	14: 27,477,130	L1335S	possibly damaging	Het
Frem2	A	G	3: 53,652,070	I1672T	probably benign	Het
Gm12166	T	A	11: 46,052,026	K90M	probably damaging	Het
Gprc6a	C	A	10: 51,621,101	V449L	probably benign	Het
H2-M10.4	A	G	17: 36,461,985	V35A	probably benign	Het
Hr	A	G	14: 70,563,584	T699A	probably benign	Het
Iffo1	A	G	6: 125,160,589		probably benign	Het
Iqgap1	G	A	7: 80,759,934	H218Y	probably damaging	Het
Itpr3	A	C	17: 27,085,131	K109Q	probably benign	Het
Itpr3	A	G	17: 27,091,572	D443G	probably damaging	Het
Katna1	T	C	10: 7,752,754	M249T	probably damaging	Het
Klk1b4	G	A	7: 44,211,593	G220D	probably damaging	Het
Krt24	A	G	11: 99,282,770	C242R	probably benign	Het
Madd	G	A	2: 91,176,828	T313I	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Micalcl	A	G	7: 112,407,678		probably null	Het
Neil3	T	C	8: 53,623,664	T79A	probably damaging	Het
Nras	A	G	3: 103,060,225	I46V	probably benign	Het
Olfr1196	T	C	2: 88,700,448	S294G	probably benign	Het
Olfr1369-ps1	T	A	13: 21,115,861	H56Q	probably benign	Het
Ppfia2	A	G	10: 106,830,629	T399A	possibly damaging	Het
Rarres1	A	G	3: 67,495,810	V86A	probably benign	Het
Rdh19	A	T	10: 127,850,075	R19W	possibly damaging	Het
Rock2	A	G	12: 16,972,736	K1059E	probably damaging	Het
Sparcl1	T	C	5: 104,092,781	H259R	probably benign	Het
Spata31d1c	A	G	13: 65,035,160	D172G	possibly damaging	Het
Stab2	T	C	10: 86,863,456	D515G	possibly damaging	Het
Sycp2l	A	G	13: 41,141,964	I334M	probably damaging	Het
Tas2r103	A	G	6: 133,036,317	L262P	probably benign	Het
Tcaf2	A	G	6: 42,642,547	V182A	probably damaging	Het
Tcof1	C	T	18: 60,831,533	E674K	possibly damaging	Het
Trp63	A	G	16: 25,820,740		probably benign	Het
Ttn	A	T	2: 76,745,394	W25052R	probably damaging	Het
Ubr1	T	A	2: 120,862,687	N1746I	probably benign	Het
Vax2	T	C	6: 83,737,547	V148A	probably damaging	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Vmn2r96	T	A	17: 18,597,679	I698N	probably damaging	Het
Wdr90	A	G	17: 25,859,278	V372A	probably benign	Het
Zfp335	C	T	2: 164,910,638	G62D	probably benign	Het
Zfp563	G	A	17: 33,105,727	R432H	probably benign	Het
Zhx1	T	C	15: 58,053,240	T537A	probably benign	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0685:Chl1	UTSW	6	103708542	splice site	probably null
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	splice site	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2291:Chl1	UTSW	6	103715393	missense	probably damaging	1.00
R2920:Chl1	UTSW	6	103695343	missense	probably damaging	1.00
R3611:Chl1	UTSW	6	103698155	missense	probably damaging	1.00
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6179:Chl1	UTSW	6	103683243	missense	probably benign	0.38
R6366:Chl1	UTSW	6	103729236	missense	possibly damaging	0.95
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94
R7838:Chl1	UTSW	6	103691674	missense	probably benign	0.01
R7863:Chl1	UTSW	6	103706514	missense	possibly damaging	0.46
R7874:Chl1	UTSW	6	103690263	missense	probably benign	0.22
R7998:Chl1	UTSW	6	103729289	missense	probably benign	0.01
R8044:Chl1	UTSW	6	103706632	missense	probably damaging	0.96
R8059:Chl1	UTSW	6	103674987	missense	probably damaging	0.97
R8462:Chl1	UTSW	6	103729169	missense	probably benign	0.11
R8558:Chl1	UTSW	6	103708429	missense	probably benign	0.14
R8827:Chl1	UTSW	6	103693150	missense	probably benign
R8865:Chl1	UTSW	6	103708861	missense	probably damaging	0.99
R8939:Chl1	UTSW	6	103665907	missense	probably damaging	1.00
R9092:Chl1	UTSW	6	103668854	unclassified	probably benign
Z1177:Chl1	UTSW	6	103693096	nonsense	probably null
Z1177:Chl1	UTSW	6	103697949	start gained	probably benign
Z1191:Chl1	UTSW	6	103683211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGTGTCCCAACAAAATGC -3'
(R):5'- CCGTGTAACTTTTATGAGAGCTTC -3'

Sequencing Primer
(F):5'- CAGATTACTGTATTTCCAATGGGCTC -3'
(R):5'- ATGAGAGCTTCCCTGTCTATGAG -3'

Posted On

2015-04-29