Incidental Mutation 'R3979:Tas2r103'
ID311187
Institutional Source Beutler Lab
Gene Symbol Tas2r103
Ensembl Gene ENSMUSG00000030196
Gene Nametaste receptor, type 2, member 103
Synonymsmt2r63, T2R3, Tas2r10, EG667992, mGR03, TRB2, Tas2r3
MMRRC Submission 040942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3979 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location133036163-133037101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133036317 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 262 (L262P)
Ref Sequence ENSEMBL: ENSMUSP00000032317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032317]
Predicted Effect probably benign
Transcript: ENSMUST00000032317
AA Change: L262P

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032317
Gene: ENSMUSG00000030196
AA Change: L262P

DomainStartEndE-ValueType
Pfam:TAS2R 5 301 1.5e-79 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,323,976 V82A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ak3 T A 19: 29,047,718 S38C probably damaging Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arhgap10 T C 8: 77,420,725 N170S probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cachd1 A T 4: 100,970,888 D611V probably damaging Het
Cfap70 T A 14: 20,439,719 E246D probably benign Het
Chl1 T A 6: 103,715,284 Y294* probably null Het
Chrna2 T A 14: 66,148,953 Y183N probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dnajb6 T C 5: 29,751,008 F46L possibly damaging Het
Exoc7 T C 11: 116,296,762 E275G probably benign Het
Fam208a T C 14: 27,477,130 L1335S possibly damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gm12166 T A 11: 46,052,026 K90M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
H2-M10.4 A G 17: 36,461,985 V35A probably benign Het
Hr A G 14: 70,563,584 T699A probably benign Het
Iffo1 A G 6: 125,160,589 probably benign Het
Iqgap1 G A 7: 80,759,934 H218Y probably damaging Het
Itpr3 A C 17: 27,085,131 K109Q probably benign Het
Itpr3 A G 17: 27,091,572 D443G probably damaging Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Klk1b4 G A 7: 44,211,593 G220D probably damaging Het
Krt24 A G 11: 99,282,770 C242R probably benign Het
Madd G A 2: 91,176,828 T313I possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Micalcl A G 7: 112,407,678 probably null Het
Neil3 T C 8: 53,623,664 T79A probably damaging Het
Nras A G 3: 103,060,225 I46V probably benign Het
Olfr1196 T C 2: 88,700,448 S294G probably benign Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Rarres1 A G 3: 67,495,810 V86A probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rock2 A G 12: 16,972,736 K1059E probably damaging Het
Sparcl1 T C 5: 104,092,781 H259R probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Stab2 T C 10: 86,863,456 D515G possibly damaging Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tcaf2 A G 6: 42,642,547 V182A probably damaging Het
Tcof1 C T 18: 60,831,533 E674K possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Ttn A T 2: 76,745,394 W25052R probably damaging Het
Ubr1 T A 2: 120,862,687 N1746I probably benign Het
Vax2 T C 6: 83,737,547 V148A probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Wdr90 A G 17: 25,859,278 V372A probably benign Het
Zfp335 C T 2: 164,910,638 G62D probably benign Het
Zfp563 G A 17: 33,105,727 R432H probably benign Het
Zhx1 T C 15: 58,053,240 T537A probably benign Het
Other mutations in Tas2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Tas2r103 APN 6 133037056 missense possibly damaging 0.86
IGL02332:Tas2r103 APN 6 133036512 missense probably benign 0.21
IGL03122:Tas2r103 APN 6 133036909 missense probably damaging 1.00
IGL03167:Tas2r103 APN 6 133036660 missense probably damaging 0.98
R0380:Tas2r103 UTSW 6 133036203 missense probably damaging 1.00
R0671:Tas2r103 UTSW 6 133036350 missense probably benign 0.01
R1700:Tas2r103 UTSW 6 133036811 missense probably damaging 1.00
R2098:Tas2r103 UTSW 6 133036597 missense probably benign
R3977:Tas2r103 UTSW 6 133036317 missense probably benign 0.16
R3980:Tas2r103 UTSW 6 133036317 missense probably benign 0.16
R4924:Tas2r103 UTSW 6 133036198 missense probably benign 0.02
R5779:Tas2r103 UTSW 6 133036945 missense probably benign 0.02
R5839:Tas2r103 UTSW 6 133036816 missense probably benign 0.06
R6265:Tas2r103 UTSW 6 133036531 missense probably damaging 1.00
R7768:Tas2r103 UTSW 6 133036849 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCCCTGATATGATTTAGGGGC -3'
(R):5'- GCACTGGGTTTACACTCACC -3'

Sequencing Primer
(F):5'- ATGATTTAGGGGCCCCAATTC -3'
(R):5'- CATTCGCTGTGTCTTTGACAATG -3'
Posted On2015-04-29