Mutagenetix > Incidental Mutations

Incidental Mutation 'R3979:Gprc6a'

311195

Institutional Source

Beutler Lab

Gene Symbol

Gprc6a

Ensembl Gene

ENSMUSG00000019905

Gene Name

G protein-coupled receptor, family C, group 6, member A

Synonyms

MMRRC Submission

040942-MU

Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3979 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

51614823-51631461 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 51621101 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 449 (V449L)

Ref Sequence

ENSEMBL: ENSMUSP00000020062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]

AlphaFold

Q8K4Z6

Predicted Effect

probably benign
Transcript: ENSMUST00000020062
AA Change: V449L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: V449L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	73	482	2.3e-62	PFAM
Pfam:NCD3G	519	572	5.9e-18	PFAM
Pfam:7tm_3	600	838	2e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218684
AA Change: V274L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000219286

Meta Mutation Damage Score

0.1205

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,323,976	V82A	probably benign	Het
Adam28	A	G	14: 68,610,994	V671A	probably benign	Het
Ak3	T	A	19: 29,047,718	S38C	probably damaging	Het
Arfgef1	A	G	1: 10,209,634	V236A	probably benign	Het
Arhgap10	T	C	8: 77,420,725	N170S	probably benign	Het
B020004C17Rik	G	T	14: 57,017,188	M156I	possibly damaging	Het
Bicral	T	A	17: 46,830,991	M1L	unknown	Het
Bop1	A	G	15: 76,453,876	L598P	probably damaging	Het
Cachd1	A	T	4: 100,970,888	D611V	probably damaging	Het
Cfap70	T	A	14: 20,439,719	E246D	probably benign	Het
Chl1	T	A	6: 103,715,284	Y294*	probably null	Het
Chrna2	T	A	14: 66,148,953	Y183N	probably damaging	Het
Dab2	A	G	15: 6,435,163		probably null	Het
Dnajb6	T	C	5: 29,751,008	F46L	possibly damaging	Het
Exoc7	T	C	11: 116,296,762	E275G	probably benign	Het
Fam208a	T	C	14: 27,477,130	L1335S	possibly damaging	Het
Frem2	A	G	3: 53,652,070	I1672T	probably benign	Het
Gm12166	T	A	11: 46,052,026	K90M	probably damaging	Het
H2-M10.4	A	G	17: 36,461,985	V35A	probably benign	Het
Hr	A	G	14: 70,563,584	T699A	probably benign	Het
Iffo1	A	G	6: 125,160,589		probably benign	Het
Iqgap1	G	A	7: 80,759,934	H218Y	probably damaging	Het
Itpr3	A	G	17: 27,091,572	D443G	probably damaging	Het
Itpr3	A	C	17: 27,085,131	K109Q	probably benign	Het
Katna1	T	C	10: 7,752,754	M249T	probably damaging	Het
Klk1b4	G	A	7: 44,211,593	G220D	probably damaging	Het
Krt24	A	G	11: 99,282,770	C242R	probably benign	Het
Madd	G	A	2: 91,176,828	T313I	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Micalcl	A	G	7: 112,407,678		probably null	Het
Neil3	T	C	8: 53,623,664	T79A	probably damaging	Het
Nras	A	G	3: 103,060,225	I46V	probably benign	Het
Olfr1196	T	C	2: 88,700,448	S294G	probably benign	Het
Olfr1369-ps1	T	A	13: 21,115,861	H56Q	probably benign	Het
Ppfia2	A	G	10: 106,830,629	T399A	possibly damaging	Het
Rarres1	A	G	3: 67,495,810	V86A	probably benign	Het
Rdh19	A	T	10: 127,850,075	R19W	possibly damaging	Het
Rock2	A	G	12: 16,972,736	K1059E	probably damaging	Het
Sparcl1	T	C	5: 104,092,781	H259R	probably benign	Het
Spata31d1c	A	G	13: 65,035,160	D172G	possibly damaging	Het
Stab2	T	C	10: 86,863,456	D515G	possibly damaging	Het
Sycp2l	A	G	13: 41,141,964	I334M	probably damaging	Het
Tas2r103	A	G	6: 133,036,317	L262P	probably benign	Het
Tcaf2	A	G	6: 42,642,547	V182A	probably damaging	Het
Tcof1	C	T	18: 60,831,533	E674K	possibly damaging	Het
Trp63	A	G	16: 25,820,740		probably benign	Het
Ttn	A	T	2: 76,745,394	W25052R	probably damaging	Het
Ubr1	T	A	2: 120,862,687	N1746I	probably benign	Het
Vax2	T	C	6: 83,737,547	V148A	probably damaging	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Vmn2r96	T	A	17: 18,597,679	I698N	probably damaging	Het
Wdr90	A	G	17: 25,859,278	V372A	probably benign	Het
Zfp335	C	T	2: 164,910,638	G62D	probably benign	Het
Zfp563	G	A	17: 33,105,727	R432H	probably benign	Het
Zhx1	T	C	15: 58,053,240	T537A	probably benign	Het

Other mutations in Gprc6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Gprc6a	APN	10	51615430	missense	probably damaging	1.00
IGL01640:Gprc6a	APN	10	51627084	missense	probably damaging	0.99
IGL02122:Gprc6a	APN	10	51626723	missense	probably benign
IGL02317:Gprc6a	APN	10	51620953	missense	probably benign	0.01
IGL02995:Gprc6a	APN	10	51626799	missense	probably damaging	1.00
IGL03229:Gprc6a	APN	10	51616603	missense	probably damaging	1.00
IGL03256:Gprc6a	APN	10	51628349	missense	possibly damaging	0.77
IGL03290:Gprc6a	APN	10	51615872	missense	probably damaging	1.00
IGL03393:Gprc6a	APN	10	51615259	missense	probably damaging	1.00
R0040:Gprc6a	UTSW	10	51614984	nonsense	probably null
R0040:Gprc6a	UTSW	10	51614984	nonsense	probably null
R0050:Gprc6a	UTSW	10	51615389	missense	probably damaging	1.00
R0050:Gprc6a	UTSW	10	51615389	missense	probably damaging	1.00
R1495:Gprc6a	UTSW	10	51628437	missense	probably benign	0.01
R1831:Gprc6a	UTSW	10	51615806	missense	probably benign	0.22
R2108:Gprc6a	UTSW	10	51615208	missense	probably damaging	1.00
R2159:Gprc6a	UTSW	10	51615680	frame shift	probably null
R2160:Gprc6a	UTSW	10	51615680	frame shift	probably null
R2162:Gprc6a	UTSW	10	51615680	frame shift	probably null
R2229:Gprc6a	UTSW	10	51626795	missense	possibly damaging	0.50
R3009:Gprc6a	UTSW	10	51628296	missense	probably benign	0.02
R3709:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3710:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3737:Gprc6a	UTSW	10	51626911	missense	probably benign
R3914:Gprc6a	UTSW	10	51628275	missense	probably benign	0.00
R3918:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3964:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3965:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3966:Gprc6a	UTSW	10	51615680	frame shift	probably null
R3973:Gprc6a	UTSW	10	51628448	missense	possibly damaging	0.93
R3977:Gprc6a	UTSW	10	51621101	missense	probably benign	0.18
R3978:Gprc6a	UTSW	10	51621101	missense	probably benign	0.18
R4306:Gprc6a	UTSW	10	51616639	missense	probably damaging	1.00
R4404:Gprc6a	UTSW	10	51628543	missense	probably benign	0.09
R4405:Gprc6a	UTSW	10	51628543	missense	probably benign	0.09
R4408:Gprc6a	UTSW	10	51628543	missense	probably benign	0.09
R4713:Gprc6a	UTSW	10	51631457	unclassified	probably benign
R4788:Gprc6a	UTSW	10	51615008	missense	probably benign	0.00
R5248:Gprc6a	UTSW	10	51614993	missense	probably damaging	1.00
R5263:Gprc6a	UTSW	10	51626804	missense	probably damaging	1.00
R5436:Gprc6a	UTSW	10	51626702	missense	probably benign
R5721:Gprc6a	UTSW	10	51614980	missense	probably benign	0.06
R6061:Gprc6a	UTSW	10	51615811	missense	probably damaging	1.00
R6092:Gprc6a	UTSW	10	51615077	missense	probably damaging	1.00
R6132:Gprc6a	UTSW	10	51615260	missense	possibly damaging	0.89
R6162:Gprc6a	UTSW	10	51614912	missense	probably benign	0.44
R6207:Gprc6a	UTSW	10	51626835	missense	probably benign	0.36
R6497:Gprc6a	UTSW	10	51615701	missense	probably benign	0.05
R6717:Gprc6a	UTSW	10	51615137	missense	probably damaging	1.00
R6789:Gprc6a	UTSW	10	51631316	missense	probably damaging	1.00
R6807:Gprc6a	UTSW	10	51626745	nonsense	probably null
R7000:Gprc6a	UTSW	10	51615047	missense	probably benign	0.34
R7019:Gprc6a	UTSW	10	51631412	missense	possibly damaging	0.68
R7143:Gprc6a	UTSW	10	51614890	missense	probably benign
R7173:Gprc6a	UTSW	10	51628499	missense	probably benign	0.01
R7579:Gprc6a	UTSW	10	51626787	missense	probably benign
R7736:Gprc6a	UTSW	10	51615453	missense	possibly damaging	0.82
R7920:Gprc6a	UTSW	10	51614930	missense	probably benign	0.02
R8273:Gprc6a	UTSW	10	51631274	missense	probably benign
R8329:Gprc6a	UTSW	10	51627259	nonsense	probably null
R8517:Gprc6a	UTSW	10	51631241	missense	probably benign	0.00
R8723:Gprc6a	UTSW	10	51615422	missense	probably damaging	1.00
R8815:Gprc6a	UTSW	10	51620983	missense	probably benign	0.00
R8829:Gprc6a	UTSW	10	51615199	missense	probably damaging	0.99
R9151:Gprc6a	UTSW	10	51621086	missense	possibly damaging	0.94
R9420:Gprc6a	UTSW	10	51615410	missense	probably damaging	0.99
Z1177:Gprc6a	UTSW	10	51615209	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTCTGCAAAACAGCCTAGGAC -3'
(R):5'- GGTGGGACTCTTTCTTAAACTGTTC -3'

Sequencing Primer
(F):5'- GGACAAAAATCACCTTAAGTTTCCTG -3'
(R):5'- AGTGTCTTCACGGGGATA -3'

Posted On

2015-04-29