Incidental Mutation 'R3979:Gprc6a'
ID 311195
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 040942-MU
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Essential gene? Non essential (E-score: 0.000) question?
Stock # R3979 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 51614823-51631461 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 51621101 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 449 (V449L)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: V449L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: V449L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: V274L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
Meta Mutation Damage Score 0.1205 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,323,976 V82A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ak3 T A 19: 29,047,718 S38C probably damaging Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arhgap10 T C 8: 77,420,725 N170S probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cachd1 A T 4: 100,970,888 D611V probably damaging Het
Cfap70 T A 14: 20,439,719 E246D probably benign Het
Chl1 T A 6: 103,715,284 Y294* probably null Het
Chrna2 T A 14: 66,148,953 Y183N probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dnajb6 T C 5: 29,751,008 F46L possibly damaging Het
Exoc7 T C 11: 116,296,762 E275G probably benign Het
Fam208a T C 14: 27,477,130 L1335S possibly damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gm12166 T A 11: 46,052,026 K90M probably damaging Het
H2-M10.4 A G 17: 36,461,985 V35A probably benign Het
Hr A G 14: 70,563,584 T699A probably benign Het
Iffo1 A G 6: 125,160,589 probably benign Het
Iqgap1 G A 7: 80,759,934 H218Y probably damaging Het
Itpr3 A C 17: 27,085,131 K109Q probably benign Het
Itpr3 A G 17: 27,091,572 D443G probably damaging Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Klk1b4 G A 7: 44,211,593 G220D probably damaging Het
Krt24 A G 11: 99,282,770 C242R probably benign Het
Madd G A 2: 91,176,828 T313I possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Micalcl A G 7: 112,407,678 probably null Het
Neil3 T C 8: 53,623,664 T79A probably damaging Het
Nras A G 3: 103,060,225 I46V probably benign Het
Olfr1196 T C 2: 88,700,448 S294G probably benign Het
Olfr1369-ps1 T A 13: 21,115,861 H56Q probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Rarres1 A G 3: 67,495,810 V86A probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rock2 A G 12: 16,972,736 K1059E probably damaging Het
Sparcl1 T C 5: 104,092,781 H259R probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Stab2 T C 10: 86,863,456 D515G possibly damaging Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tcaf2 A G 6: 42,642,547 V182A probably damaging Het
Tcof1 C T 18: 60,831,533 E674K possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Ttn A T 2: 76,745,394 W25052R probably damaging Het
Ubr1 T A 2: 120,862,687 N1746I probably benign Het
Vax2 T C 6: 83,737,547 V148A probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Wdr90 A G 17: 25,859,278 V372A probably benign Het
Zfp335 C T 2: 164,910,638 G62D probably benign Het
Zfp563 G A 17: 33,105,727 R432H probably benign Het
Zhx1 T C 15: 58,053,240 T537A probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
R8829:Gprc6a UTSW 10 51615199 missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51621086 missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51615410 missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51628268 missense probably benign 0.20
R9766:Gprc6a UTSW 10 51615788 missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTGCAAAACAGCCTAGGAC -3'
(R):5'- GGTGGGACTCTTTCTTAAACTGTTC -3'

Sequencing Primer
(F):5'- GGACAAAAATCACCTTAAGTTTCCTG -3'
(R):5'- AGTGTCTTCACGGGGATA -3'
Posted On 2015-04-29