Incidental Mutation 'R3979:Olfr1369-ps1'
ID 311202
Institutional Source Beutler Lab
Gene Symbol Olfr1369-ps1
Ensembl Gene ENSMUSG00000060404
Gene Name olfactory receptor 1369, pseudogene 1
Synonyms GA_x6K02T2QHY8-12126170-12125935, MOR256-31
MMRRC Submission 040942-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock # R3979 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 21111483-21119095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21115861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 56 (H56Q)
Ref Sequence ENSEMBL: ENSMUSP00000151041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079050] [ENSMUST00000213326] [ENSMUST00000213922] [ENSMUST00000215207] [ENSMUST00000215941]
AlphaFold A0A140T8K7
Predicted Effect probably benign
Transcript: ENSMUST00000079050
AA Change: H56Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000078059
Gene: ENSMUSG00000060404
AA Change: H56Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-47 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213326
AA Change: H56Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000213922
AA Change: H56Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215207
AA Change: H56Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215941
AA Change: H56Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,323,976 V82A probably benign Het
Adam28 A G 14: 68,610,994 V671A probably benign Het
Ak3 T A 19: 29,047,718 S38C probably damaging Het
Arfgef1 A G 1: 10,209,634 V236A probably benign Het
Arhgap10 T C 8: 77,420,725 N170S probably benign Het
B020004C17Rik G T 14: 57,017,188 M156I possibly damaging Het
Bicral T A 17: 46,830,991 M1L unknown Het
Bop1 A G 15: 76,453,876 L598P probably damaging Het
Cachd1 A T 4: 100,970,888 D611V probably damaging Het
Cfap70 T A 14: 20,439,719 E246D probably benign Het
Chl1 T A 6: 103,715,284 Y294* probably null Het
Chrna2 T A 14: 66,148,953 Y183N probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Dnajb6 T C 5: 29,751,008 F46L possibly damaging Het
Exoc7 T C 11: 116,296,762 E275G probably benign Het
Fam208a T C 14: 27,477,130 L1335S possibly damaging Het
Frem2 A G 3: 53,652,070 I1672T probably benign Het
Gm12166 T A 11: 46,052,026 K90M probably damaging Het
Gprc6a C A 10: 51,621,101 V449L probably benign Het
H2-M10.4 A G 17: 36,461,985 V35A probably benign Het
Hr A G 14: 70,563,584 T699A probably benign Het
Iffo1 A G 6: 125,160,589 probably benign Het
Iqgap1 G A 7: 80,759,934 H218Y probably damaging Het
Itpr3 A C 17: 27,085,131 K109Q probably benign Het
Itpr3 A G 17: 27,091,572 D443G probably damaging Het
Katna1 T C 10: 7,752,754 M249T probably damaging Het
Klk1b4 G A 7: 44,211,593 G220D probably damaging Het
Krt24 A G 11: 99,282,770 C242R probably benign Het
Madd G A 2: 91,176,828 T313I possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Micalcl A G 7: 112,407,678 probably null Het
Neil3 T C 8: 53,623,664 T79A probably damaging Het
Nras A G 3: 103,060,225 I46V probably benign Het
Olfr1196 T C 2: 88,700,448 S294G probably benign Het
Ppfia2 A G 10: 106,830,629 T399A possibly damaging Het
Rarres1 A G 3: 67,495,810 V86A probably benign Het
Rdh19 A T 10: 127,850,075 R19W possibly damaging Het
Rock2 A G 12: 16,972,736 K1059E probably damaging Het
Sparcl1 T C 5: 104,092,781 H259R probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Stab2 T C 10: 86,863,456 D515G possibly damaging Het
Sycp2l A G 13: 41,141,964 I334M probably damaging Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tcaf2 A G 6: 42,642,547 V182A probably damaging Het
Tcof1 C T 18: 60,831,533 E674K possibly damaging Het
Trp63 A G 16: 25,820,740 probably benign Het
Ttn A T 2: 76,745,394 W25052R probably damaging Het
Ubr1 T A 2: 120,862,687 N1746I probably benign Het
Vax2 T C 6: 83,737,547 V148A probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r96 T A 17: 18,597,679 I698N probably damaging Het
Wdr90 A G 17: 25,859,278 V372A probably benign Het
Zfp335 C T 2: 164,910,638 G62D probably benign Het
Zfp563 G A 17: 33,105,727 R432H probably benign Het
Zhx1 T C 15: 58,053,240 T537A probably benign Het
Other mutations in Olfr1369-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Olfr1369-ps1 APN 13 21116073 missense probably damaging 0.97
R0631:Olfr1369-ps1 UTSW 13 21115908 missense probably damaging 1.00
R0960:Olfr1369-ps1 UTSW 13 21116265 missense possibly damaging 0.94
R1499:Olfr1369-ps1 UTSW 13 21116133 missense probably benign 0.32
R1549:Olfr1369-ps1 UTSW 13 21116118 missense probably benign 0.01
R1698:Olfr1369-ps1 UTSW 13 21116565 missense probably benign 0.11
R1711:Olfr1369-ps1 UTSW 13 21116306 missense probably benign 0.01
R2404:Olfr1369-ps1 UTSW 13 21115842 missense probably damaging 1.00
R2471:Olfr1369-ps1 UTSW 13 21116429 missense probably damaging 1.00
R3844:Olfr1369-ps1 UTSW 13 21116063 missense possibly damaging 0.91
R3977:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R4804:Olfr1369-ps1 UTSW 13 21116005 nonsense probably null
R4914:Olfr1369-ps1 UTSW 13 21116397 missense probably benign 0.12
R5210:Olfr1369-ps1 UTSW 13 21116052 missense probably damaging 0.99
R5359:Olfr1369-ps1 UTSW 13 21116267 missense probably damaging 1.00
R5700:Olfr1369-ps1 UTSW 13 21116001 missense probably damaging 1.00
R6218:Olfr1369-ps1 UTSW 13 21116231 missense probably damaging 1.00
R6767:Olfr1369-ps1 UTSW 13 21116057 missense probably benign 0.02
R7396:Olfr1369-ps1 UTSW 13 21116307 missense probably benign 0.02
R7476:Olfr1369-ps1 UTSW 13 21116021 missense probably benign 0.04
R7612:Olfr1369-ps1 UTSW 13 21116047 missense probably damaging 0.99
R8257:Olfr1369-ps1 UTSW 13 21116373 missense probably benign 0.11
R9388:Olfr1369-ps1 UTSW 13 21116604 missense probably damaging 0.96
V8831:Olfr1369-ps1 UTSW 13 21116003 missense possibly damaging 0.93
Z1176:Olfr1369-ps1 UTSW 13 21116601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGACTATGGACCCAAGC -3'
(R):5'- TGCAAGGGCTTACAAATAGCTG -3'

Sequencing Primer
(F):5'- GGACCCAAGCAATTACAGTACTTTG -3'
(R):5'- GGCTTACAAATAGCTGTGAAACGATC -3'
Posted On 2015-04-29