Mutagenetix > Incidental Mutation

Incidental Mutation 'R3979:Spata31d1c'

311204

Institutional Source

Beutler Lab

Gene Symbol

Spata31d1c

Ensembl Gene

ENSMUSG00000074849

Gene Name

spermatogenesis associated 31 subfamily D, member 1C

Synonyms

4932441B19Rik, Fam75d1c

MMRRC Submission

040942-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3979 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65033058-65038004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65035160 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 172 (D172G)

Ref Sequence

ENSEMBL: ENSMUSP00000097024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099427]

AlphaFold

E9QAF1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099427
AA Change: D172G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: D172G

Domain	Start	End	E-Value	Type
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:DUF4599	63	148	2.4e-31	PFAM
low complexity region	178	190	N/A	INTRINSIC
low complexity region	196	213	N/A	INTRINSIC
low complexity region	218	233	N/A	INTRINSIC
low complexity region	237	251	N/A	INTRINSIC
Pfam:FAM75	380	742	1.4e-120	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,323,976	V82A	probably benign	Het
Adam28	A	G	14: 68,610,994	V671A	probably benign	Het
Ak3	T	A	19: 29,047,718	S38C	probably damaging	Het
Arfgef1	A	G	1: 10,209,634	V236A	probably benign	Het
Arhgap10	T	C	8: 77,420,725	N170S	probably benign	Het
B020004C17Rik	G	T	14: 57,017,188	M156I	possibly damaging	Het
Bicral	T	A	17: 46,830,991	M1L	unknown	Het
Bop1	A	G	15: 76,453,876	L598P	probably damaging	Het
Cachd1	A	T	4: 100,970,888	D611V	probably damaging	Het
Cfap70	T	A	14: 20,439,719	E246D	probably benign	Het
Chl1	T	A	6: 103,715,284	Y294*	probably null	Het
Chrna2	T	A	14: 66,148,953	Y183N	probably damaging	Het
Dab2	A	G	15: 6,435,163		probably null	Het
Dnajb6	T	C	5: 29,751,008	F46L	possibly damaging	Het
Exoc7	T	C	11: 116,296,762	E275G	probably benign	Het
Fam208a	T	C	14: 27,477,130	L1335S	possibly damaging	Het
Frem2	A	G	3: 53,652,070	I1672T	probably benign	Het
Gm12166	T	A	11: 46,052,026	K90M	probably damaging	Het
Gprc6a	C	A	10: 51,621,101	V449L	probably benign	Het
H2-M10.4	A	G	17: 36,461,985	V35A	probably benign	Het
Hr	A	G	14: 70,563,584	T699A	probably benign	Het
Iffo1	A	G	6: 125,160,589		probably benign	Het
Iqgap1	G	A	7: 80,759,934	H218Y	probably damaging	Het
Itpr3	A	C	17: 27,085,131	K109Q	probably benign	Het
Itpr3	A	G	17: 27,091,572	D443G	probably damaging	Het
Katna1	T	C	10: 7,752,754	M249T	probably damaging	Het
Klk1b4	G	A	7: 44,211,593	G220D	probably damaging	Het
Krt24	A	G	11: 99,282,770	C242R	probably benign	Het
Madd	G	A	2: 91,176,828	T313I	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Micalcl	A	G	7: 112,407,678		probably null	Het
Neil3	T	C	8: 53,623,664	T79A	probably damaging	Het
Nras	A	G	3: 103,060,225	I46V	probably benign	Het
Olfr1196	T	C	2: 88,700,448	S294G	probably benign	Het
Olfr1369-ps1	T	A	13: 21,115,861	H56Q	probably benign	Het
Ppfia2	A	G	10: 106,830,629	T399A	possibly damaging	Het
Rarres1	A	G	3: 67,495,810	V86A	probably benign	Het
Rdh19	A	T	10: 127,850,075	R19W	possibly damaging	Het
Rock2	A	G	12: 16,972,736	K1059E	probably damaging	Het
Sparcl1	T	C	5: 104,092,781	H259R	probably benign	Het
Stab2	T	C	10: 86,863,456	D515G	possibly damaging	Het
Sycp2l	A	G	13: 41,141,964	I334M	probably damaging	Het
Tas2r103	A	G	6: 133,036,317	L262P	probably benign	Het
Tcaf2	A	G	6: 42,642,547	V182A	probably damaging	Het
Tcof1	C	T	18: 60,831,533	E674K	possibly damaging	Het
Trp63	A	G	16: 25,820,740		probably benign	Het
Ttn	A	T	2: 76,745,394	W25052R	probably damaging	Het
Ubr1	T	A	2: 120,862,687	N1746I	probably benign	Het
Vax2	T	C	6: 83,737,547	V148A	probably damaging	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Vmn2r96	T	A	17: 18,597,679	I698N	probably damaging	Het
Wdr90	A	G	17: 25,859,278	V372A	probably benign	Het
Zfp335	C	T	2: 164,910,638	G62D	probably benign	Het
Zfp563	G	A	17: 33,105,727	R432H	probably benign	Het
Zhx1	T	C	15: 58,053,240	T537A	probably benign	Het

Other mutations in Spata31d1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Spata31d1c	APN	13	65036089	missense	probably damaging	1.00
IGL02830:Spata31d1c	APN	13	65035366	missense	probably benign	0.25
IGL02947:Spata31d1c	APN	13	65034945	nonsense	probably null
IGL03133:Spata31d1c	APN	13	65034985	missense	probably benign	0.18
IGL03176:Spata31d1c	APN	13	65037011	missense	probably benign	0.01
IGL03183:Spata31d1c	APN	13	65035195	missense	possibly damaging	0.86
IGL03206:Spata31d1c	APN	13	65035593	missense	probably benign	0.41
PIT4382001:Spata31d1c	UTSW	13	65036171	missense	probably benign	0.01
R0054:Spata31d1c	UTSW	13	65033062	start gained	probably benign
R0959:Spata31d1c	UTSW	13	65036315	missense	probably damaging	1.00
R1232:Spata31d1c	UTSW	13	65036614	missense	probably benign
R1347:Spata31d1c	UTSW	13	65035388	missense	probably benign	0.00
R1381:Spata31d1c	UTSW	13	65036554	missense	probably benign	0.08
R1573:Spata31d1c	UTSW	13	65035069	missense	possibly damaging	0.92
R1582:Spata31d1c	UTSW	13	65033224	missense	probably benign
R1639:Spata31d1c	UTSW	13	65036039	missense	probably benign
R1716:Spata31d1c	UTSW	13	65033216	missense	possibly damaging	0.86
R1781:Spata31d1c	UTSW	13	65036171	missense	probably benign	0.01
R1907:Spata31d1c	UTSW	13	65035876	missense	probably benign	0.03
R2012:Spata31d1c	UTSW	13	65035227	missense	possibly damaging	0.91
R2152:Spata31d1c	UTSW	13	65033965	critical splice donor site	probably null
R2211:Spata31d1c	UTSW	13	65035939	missense	probably benign	0.04
R2571:Spata31d1c	UTSW	13	65036384	missense	probably damaging	1.00
R2908:Spata31d1c	UTSW	13	65033191	missense	possibly damaging	0.63
R3978:Spata31d1c	UTSW	13	65035160	missense	possibly damaging	0.61
R3980:Spata31d1c	UTSW	13	65035160	missense	possibly damaging	0.61
R3981:Spata31d1c	UTSW	13	65035111	missense	possibly damaging	0.68
R4014:Spata31d1c	UTSW	13	65035399	missense	probably damaging	0.99
R4255:Spata31d1c	UTSW	13	65035688	nonsense	probably null
R4255:Spata31d1c	UTSW	13	65035717	missense	probably benign	0.04
R4592:Spata31d1c	UTSW	13	65036060	missense	probably damaging	0.99
R4597:Spata31d1c	UTSW	13	65035613	nonsense	probably null
R4624:Spata31d1c	UTSW	13	65036597	missense	probably benign
R4641:Spata31d1c	UTSW	13	65035048	missense	probably benign	0.01
R4863:Spata31d1c	UTSW	13	65035790	nonsense	probably null
R5084:Spata31d1c	UTSW	13	65035130	missense	probably damaging	0.98
R5152:Spata31d1c	UTSW	13	65035595	missense	probably damaging	1.00
R5230:Spata31d1c	UTSW	13	65035434	missense	probably benign	0.41
R5267:Spata31d1c	UTSW	13	65035904	missense	probably damaging	0.98
R5615:Spata31d1c	UTSW	13	65035264	missense	possibly damaging	0.61
R5755:Spata31d1c	UTSW	13	65036527	missense	probably benign	0.12
R5935:Spata31d1c	UTSW	13	65037080	missense	possibly damaging	0.68
R6017:Spata31d1c	UTSW	13	65035079	missense	possibly damaging	0.91
R6131:Spata31d1c	UTSW	13	65035671	missense	probably benign	0.10
R6359:Spata31d1c	UTSW	13	65035592	missense	possibly damaging	0.63
R6723:Spata31d1c	UTSW	13	65035944	missense	probably benign	0.01
R7028:Spata31d1c	UTSW	13	65036063	missense	probably damaging	0.98
R7336:Spata31d1c	UTSW	13	65036128	missense	probably damaging	0.99
R7426:Spata31d1c	UTSW	13	65035361	missense	probably benign
R7552:Spata31d1c	UTSW	13	65036123	missense	probably damaging	0.98
R7605:Spata31d1c	UTSW	13	65035840	missense	probably benign	0.00
R7666:Spata31d1c	UTSW	13	65036000	missense	probably benign	0.01
R8403:Spata31d1c	UTSW	13	65036230	missense	probably benign	0.42
R8445:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8513:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8515:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8523:Spata31d1c	UTSW	13	65033177	missense	probably damaging	0.98
R8799:Spata31d1c	UTSW	13	65036326	missense	possibly damaging	0.92
R8817:Spata31d1c	UTSW	13	65034562	missense	probably damaging	0.98
R8854:Spata31d1c	UTSW	13	65035990	missense	possibly damaging	0.82
R8917:Spata31d1c	UTSW	13	65035615	missense	probably benign	0.02
R9084:Spata31d1c	UTSW	13	65035145	missense	probably benign
R9197:Spata31d1c	UTSW	13	65035876	missense	probably benign	0.01
R9201:Spata31d1c	UTSW	13	65036959	missense	possibly damaging	0.48
R9261:Spata31d1c	UTSW	13	65036866	missense	probably damaging	0.99
R9516:Spata31d1c	UTSW	13	65036226	missense	probably damaging	1.00
X0022:Spata31d1c	UTSW	13	65036927	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CAGATCCCTACTGTGGTGTGTG -3'
(R):5'- AAGCAGTTCTGTTTCCGGAG -3'

Sequencing Primer
(F):5'- GTGTGTAATGGAGCAACTGC -3'
(R):5'- CTGTTTCCGGAGTGACATATTG -3'

Posted On

2015-04-29