Incidental Mutation 'R3979:Itpr3'
ID 311217
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms Itpr-3, Ip3r3, tf
MMRRC Submission 040942-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3979 (G1)
Quality Score 127
Status Not validated
Chromosome 17
Chromosomal Location 27276278-27341197 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 27304105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamine at position 109 (K109Q)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
AlphaFold P70227
PDB Structure Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049308
AA Change: K109Q

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: K109Q

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,154,320 (GRCm39) V82A probably benign Het
Adam28 A G 14: 68,848,443 (GRCm39) V671A probably benign Het
Ak3 T A 19: 29,025,118 (GRCm39) S38C probably damaging Het
Arfgef1 A G 1: 10,279,859 (GRCm39) V236A probably benign Het
Arhgap10 T C 8: 78,147,354 (GRCm39) N170S probably benign Het
B020004C17Rik G T 14: 57,254,645 (GRCm39) M156I possibly damaging Het
Bicral T A 17: 47,141,917 (GRCm39) M1L unknown Het
Bop1 A G 15: 76,338,076 (GRCm39) L598P probably damaging Het
Cachd1 A T 4: 100,828,085 (GRCm39) D611V probably damaging Het
Cfap70 T A 14: 20,489,787 (GRCm39) E246D probably benign Het
Chl1 T A 6: 103,692,245 (GRCm39) Y294* probably null Het
Chrna2 T A 14: 66,386,402 (GRCm39) Y183N probably damaging Het
Dab2 A G 15: 6,464,644 (GRCm39) probably null Het
Dnajb6 T C 5: 29,956,006 (GRCm39) F46L possibly damaging Het
Exoc7 T C 11: 116,187,588 (GRCm39) E275G probably benign Het
Frem2 A G 3: 53,559,491 (GRCm39) I1672T probably benign Het
Gprc6a C A 10: 51,497,197 (GRCm39) V449L probably benign Het
H2-M10.4 A G 17: 36,772,877 (GRCm39) V35A probably benign Het
Hr A G 14: 70,801,024 (GRCm39) T699A probably benign Het
Iffo1 A G 6: 125,137,552 (GRCm39) probably benign Het
Iqgap1 G A 7: 80,409,682 (GRCm39) H218Y probably damaging Het
Katna1 T C 10: 7,628,518 (GRCm39) M249T probably damaging Het
Klk1b4 G A 7: 43,861,017 (GRCm39) G220D probably damaging Het
Krt24 A G 11: 99,173,596 (GRCm39) C242R probably benign Het
Madd G A 2: 91,007,173 (GRCm39) T313I possibly damaging Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mical2 A G 7: 112,006,885 (GRCm39) probably null Het
Neil3 T C 8: 54,076,699 (GRCm39) T79A probably damaging Het
Nras A G 3: 102,967,541 (GRCm39) I46V probably benign Het
Or2w1b T A 13: 21,300,031 (GRCm39) H56Q probably benign Het
Or4a66 T C 2: 88,530,792 (GRCm39) S294G probably benign Het
Ppfia2 A G 10: 106,666,490 (GRCm39) T399A possibly damaging Het
Rarres1 A G 3: 67,403,143 (GRCm39) V86A probably benign Het
Rdh19 A T 10: 127,685,944 (GRCm39) R19W possibly damaging Het
Rock2 A G 12: 17,022,737 (GRCm39) K1059E probably damaging Het
Sft2d1rt T A 11: 45,942,853 (GRCm39) K90M probably damaging Het
Sparcl1 T C 5: 104,240,647 (GRCm39) H259R probably benign Het
Spata31d1c A G 13: 65,182,974 (GRCm39) D172G possibly damaging Het
Stab2 T C 10: 86,699,320 (GRCm39) D515G possibly damaging Het
Sycp2l A G 13: 41,295,440 (GRCm39) I334M probably damaging Het
Tas2r103 A G 6: 133,013,280 (GRCm39) L262P probably benign Het
Tasor T C 14: 27,199,087 (GRCm39) L1335S possibly damaging Het
Tcaf2 A G 6: 42,619,481 (GRCm39) V182A probably damaging Het
Tcof1 C T 18: 60,964,605 (GRCm39) E674K possibly damaging Het
Trp63 A G 16: 25,639,490 (GRCm39) probably benign Het
Ttn A T 2: 76,575,738 (GRCm39) W25052R probably damaging Het
Ubr1 T A 2: 120,693,168 (GRCm39) N1746I probably benign Het
Vax2 T C 6: 83,714,529 (GRCm39) V148A probably damaging Het
Vmn2r112 T A 17: 22,822,096 (GRCm39) V258E probably damaging Het
Vmn2r96 T A 17: 18,817,941 (GRCm39) I698N probably damaging Het
Wdr90 A G 17: 26,078,252 (GRCm39) V372A probably benign Het
Zfp335 C T 2: 164,752,558 (GRCm39) G62D probably benign Het
Zfp563 G A 17: 33,324,701 (GRCm39) R432H probably benign Het
Zhx1 T C 15: 57,916,636 (GRCm39) T537A probably benign Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27,302,603 (GRCm39) missense probably benign 0.05
IGL00980:Itpr3 APN 17 27,329,930 (GRCm39) missense probably benign
IGL01151:Itpr3 APN 17 27,310,503 (GRCm39) missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27,318,739 (GRCm39) missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27,337,569 (GRCm39) missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27,336,152 (GRCm39) missense probably benign 0.02
IGL01897:Itpr3 APN 17 27,330,236 (GRCm39) missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27,340,449 (GRCm39) missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27,323,069 (GRCm39) missense probably benign
IGL02063:Itpr3 APN 17 27,338,997 (GRCm39) missense probably benign 0.01
IGL02146:Itpr3 APN 17 27,336,249 (GRCm39) missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27,317,416 (GRCm39) missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27,318,588 (GRCm39) missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27,317,153 (GRCm39) missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27,333,486 (GRCm39) splice site probably benign
IGL02651:Itpr3 APN 17 27,325,372 (GRCm39) missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27,323,530 (GRCm39) missense probably benign 0.21
IGL03001:Itpr3 APN 17 27,308,586 (GRCm39) splice site probably benign
IGL03004:Itpr3 APN 17 27,316,952 (GRCm39) missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27,310,907 (GRCm39) missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27,338,240 (GRCm39) missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27,330,242 (GRCm39) missense probably benign
IGL03404:Itpr3 APN 17 27,310,492 (GRCm39) missense probably damaging 1.00
Allure UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
alopecia UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Beauty UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
Opuesto UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
Paradox UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
Pulchritude UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27,339,951 (GRCm39) missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27,317,296 (GRCm39) missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0104:Itpr3 UTSW 17 27,314,966 (GRCm39) missense probably benign 0.01
R0195:Itpr3 UTSW 17 27,333,088 (GRCm39) missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27,308,293 (GRCm39) missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27,332,793 (GRCm39) missense probably benign
R0485:Itpr3 UTSW 17 27,330,903 (GRCm39) missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27,326,263 (GRCm39) missense probably benign 0.09
R0781:Itpr3 UTSW 17 27,329,529 (GRCm39) missense probably benign 0.00
R0890:Itpr3 UTSW 17 27,307,985 (GRCm39) nonsense probably null
R1028:Itpr3 UTSW 17 27,310,343 (GRCm39) missense probably benign 0.04
R1144:Itpr3 UTSW 17 27,333,897 (GRCm39) missense probably benign 0.01
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1458:Itpr3 UTSW 17 27,337,346 (GRCm39) missense probably benign 0.01
R1463:Itpr3 UTSW 17 27,336,128 (GRCm39) splice site probably benign
R1472:Itpr3 UTSW 17 27,333,199 (GRCm39) missense probably benign 0.09
R1529:Itpr3 UTSW 17 27,324,459 (GRCm39) splice site probably null
R1533:Itpr3 UTSW 17 27,314,534 (GRCm39) missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27,333,121 (GRCm39) missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27,335,581 (GRCm39) critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27,307,987 (GRCm39) missense probably benign
R1726:Itpr3 UTSW 17 27,330,664 (GRCm39) missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27,338,997 (GRCm39) missense probably benign 0.01
R1940:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27,321,785 (GRCm39) missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2064:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2065:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2067:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2068:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2219:Itpr3 UTSW 17 27,334,027 (GRCm39) missense probably benign
R2248:Itpr3 UTSW 17 27,334,033 (GRCm39) missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27,332,553 (GRCm39) missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27,314,889 (GRCm39) missense probably benign
R2864:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R2865:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R3778:Itpr3 UTSW 17 27,314,446 (GRCm39) missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27,332,814 (GRCm39) missense probably benign 0.01
R3979:Itpr3 UTSW 17 27,310,546 (GRCm39) missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27,326,232 (GRCm39) missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27,325,298 (GRCm39) missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27,330,948 (GRCm39) missense probably benign 0.00
R4466:Itpr3 UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27,323,586 (GRCm39) missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27,312,257 (GRCm39) missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27,304,121 (GRCm39) missense probably benign 0.30
R4921:Itpr3 UTSW 17 27,316,979 (GRCm39) missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27,302,582 (GRCm39) missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27,308,885 (GRCm39) missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27,317,397 (GRCm39) missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27,335,663 (GRCm39) missense probably benign 0.38
R5518:Itpr3 UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27,326,308 (GRCm39) missense probably benign 0.09
R5566:Itpr3 UTSW 17 27,334,926 (GRCm39) missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27,322,880 (GRCm39) missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27,332,493 (GRCm39) missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27,337,540 (GRCm39) missense probably benign 0.42
R5658:Itpr3 UTSW 17 27,326,852 (GRCm39) missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27,325,379 (GRCm39) missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27,305,950 (GRCm39) missense probably benign 0.02
R5878:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R5889:Itpr3 UTSW 17 27,334,039 (GRCm39) missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27,336,867 (GRCm39) missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27,329,895 (GRCm39) missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27,323,575 (GRCm39) missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27,330,174 (GRCm39) missense probably benign 0.03
R6233:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27,314,449 (GRCm39) missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6515:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6516:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6955:Itpr3 UTSW 17 27,340,441 (GRCm39) missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27,329,554 (GRCm39) missense probably benign 0.00
R7064:Itpr3 UTSW 17 27,308,269 (GRCm39) missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27,337,535 (GRCm39) missense probably benign 0.00
R7349:Itpr3 UTSW 17 27,326,786 (GRCm39) splice site probably null
R7469:Itpr3 UTSW 17 27,340,028 (GRCm39) missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27,313,774 (GRCm39) missense probably benign 0.09
R7510:Itpr3 UTSW 17 27,308,013 (GRCm39) missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27,329,862 (GRCm39) missense probably benign 0.01
R7616:Itpr3 UTSW 17 27,307,951 (GRCm39) missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27,317,088 (GRCm39) missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27,315,037 (GRCm39) missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27,337,571 (GRCm39) nonsense probably null
R7871:Itpr3 UTSW 17 27,336,153 (GRCm39) missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27,335,751 (GRCm39) missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27,331,002 (GRCm39) critical splice donor site probably null
R8065:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8067:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8230:Itpr3 UTSW 17 27,326,711 (GRCm39) critical splice donor site probably null
R8263:Itpr3 UTSW 17 27,334,887 (GRCm39) nonsense probably null
R8264:Itpr3 UTSW 17 27,323,086 (GRCm39) synonymous silent
R8269:Itpr3 UTSW 17 27,312,258 (GRCm39) missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27,306,622 (GRCm39) missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27,325,199 (GRCm39) missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27,334,893 (GRCm39) missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27,330,900 (GRCm39) missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8679:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8846:Itpr3 UTSW 17 27,330,996 (GRCm39) missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8885:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8886:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8887:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8888:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8891:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8896:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8975:Itpr3 UTSW 17 27,335,628 (GRCm39) missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9026:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9063:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9087:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9088:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9089:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9090:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9091:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9200:Itpr3 UTSW 17 27,326,636 (GRCm39) missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9271:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9294:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27,314,899 (GRCm39) missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9434:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9443:Itpr3 UTSW 17 27,324,523 (GRCm39) missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9474:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9475:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9476:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9477:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9507:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9508:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9511:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9694:Itpr3 UTSW 17 27,334,927 (GRCm39) missense probably damaging 0.99
R9789:Itpr3 UTSW 17 27,308,915 (GRCm39) missense probably benign 0.15
V7732:Itpr3 UTSW 17 27,330,000 (GRCm39) splice site probably null
V7732:Itpr3 UTSW 17 27,329,998 (GRCm39) splice site probably benign
Z1088:Itpr3 UTSW 17 27,332,502 (GRCm39) missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27,338,961 (GRCm39) missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27,333,903 (GRCm39) missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGGTGAATGTGAGCCTCAG -3'
(R):5'- ACCAAAGTGCAGTCAGAGATAC -3'

Sequencing Primer
(F):5'- AATGTGAGCCTCAGTGTGTG -3'
(R):5'- TACATGTACATGCACACCCAG -3'
Posted On 2015-04-29