Mutagenetix > Incidental Mutation

Incidental Mutation 'R3979:Itpr3'

311218

Institutional Source

Beutler Lab

Gene Symbol

Itpr3

Ensembl Gene

ENSMUSG00000042644

Gene Name

inositol 1,4,5-triphosphate receptor 3

Synonyms

tf, Ip3r3, Itpr-3

MMRRC Submission

040942-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3979 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27057304-27122223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27091572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 443 (D443G)

Ref Sequence

ENSEMBL: ENSMUSP00000038150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049308]

AlphaFold

P70227

PDB Structure

Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049308
AA Change: D443G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: D443G

Domain	Start	End	E-Value	Type
MIR	113	167	7.75e-6	SMART
MIR	174	224	1.16e-4	SMART
MIR	232	288	1.21e-7	SMART
MIR	295	402	9.38e-14	SMART
Pfam:RYDR_ITPR	473	670	7.8e-64	PFAM
low complexity region	881	889	N/A	INTRINSIC
Pfam:RYDR_ITPR	1175	1333	5.8e-16	PFAM
low complexity region	1549	1567	N/A	INTRINSIC
low complexity region	1831	1851	N/A	INTRINSIC
Pfam:RIH_assoc	1863	1973	2.6e-34	PFAM
transmembrane domain	2203	2225	N/A	INTRINSIC
Pfam:Ion_trans	2235	2527	8.1e-20	PFAM
coiled coil region	2631	2660	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184226

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,323,976	V82A	probably benign	Het
Adam28	A	G	14: 68,610,994	V671A	probably benign	Het
Ak3	T	A	19: 29,047,718	S38C	probably damaging	Het
Arfgef1	A	G	1: 10,209,634	V236A	probably benign	Het
Arhgap10	T	C	8: 77,420,725	N170S	probably benign	Het
B020004C17Rik	G	T	14: 57,017,188	M156I	possibly damaging	Het
Bicral	T	A	17: 46,830,991	M1L	unknown	Het
Bop1	A	G	15: 76,453,876	L598P	probably damaging	Het
Cachd1	A	T	4: 100,970,888	D611V	probably damaging	Het
Cfap70	T	A	14: 20,439,719	E246D	probably benign	Het
Chl1	T	A	6: 103,715,284	Y294*	probably null	Het
Chrna2	T	A	14: 66,148,953	Y183N	probably damaging	Het
Dab2	A	G	15: 6,435,163		probably null	Het
Dnajb6	T	C	5: 29,751,008	F46L	possibly damaging	Het
Exoc7	T	C	11: 116,296,762	E275G	probably benign	Het
Fam208a	T	C	14: 27,477,130	L1335S	possibly damaging	Het
Frem2	A	G	3: 53,652,070	I1672T	probably benign	Het
Gm12166	T	A	11: 46,052,026	K90M	probably damaging	Het
Gprc6a	C	A	10: 51,621,101	V449L	probably benign	Het
H2-M10.4	A	G	17: 36,461,985	V35A	probably benign	Het
Hr	A	G	14: 70,563,584	T699A	probably benign	Het
Iffo1	A	G	6: 125,160,589		probably benign	Het
Iqgap1	G	A	7: 80,759,934	H218Y	probably damaging	Het
Katna1	T	C	10: 7,752,754	M249T	probably damaging	Het
Klk1b4	G	A	7: 44,211,593	G220D	probably damaging	Het
Krt24	A	G	11: 99,282,770	C242R	probably benign	Het
Madd	G	A	2: 91,176,828	T313I	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Micalcl	A	G	7: 112,407,678		probably null	Het
Neil3	T	C	8: 53,623,664	T79A	probably damaging	Het
Nras	A	G	3: 103,060,225	I46V	probably benign	Het
Olfr1196	T	C	2: 88,700,448	S294G	probably benign	Het
Olfr1369-ps1	T	A	13: 21,115,861	H56Q	probably benign	Het
Ppfia2	A	G	10: 106,830,629	T399A	possibly damaging	Het
Rarres1	A	G	3: 67,495,810	V86A	probably benign	Het
Rdh19	A	T	10: 127,850,075	R19W	possibly damaging	Het
Rock2	A	G	12: 16,972,736	K1059E	probably damaging	Het
Sparcl1	T	C	5: 104,092,781	H259R	probably benign	Het
Spata31d1c	A	G	13: 65,035,160	D172G	possibly damaging	Het
Stab2	T	C	10: 86,863,456	D515G	possibly damaging	Het
Sycp2l	A	G	13: 41,141,964	I334M	probably damaging	Het
Tas2r103	A	G	6: 133,036,317	L262P	probably benign	Het
Tcaf2	A	G	6: 42,642,547	V182A	probably damaging	Het
Tcof1	C	T	18: 60,831,533	E674K	possibly damaging	Het
Trp63	A	G	16: 25,820,740		probably benign	Het
Ttn	A	T	2: 76,745,394	W25052R	probably damaging	Het
Ubr1	T	A	2: 120,862,687	N1746I	probably benign	Het
Vax2	T	C	6: 83,737,547	V148A	probably damaging	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Vmn2r96	T	A	17: 18,597,679	I698N	probably damaging	Het
Wdr90	A	G	17: 25,859,278	V372A	probably benign	Het
Zfp335	C	T	2: 164,910,638	G62D	probably benign	Het
Zfp563	G	A	17: 33,105,727	R432H	probably benign	Het
Zhx1	T	C	15: 58,053,240	T537A	probably benign	Het

Other mutations in Itpr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Itpr3	APN	17	27083629	missense	probably benign	0.05
IGL00980:Itpr3	APN	17	27110956	missense	probably benign
IGL01151:Itpr3	APN	17	27091529	missense	probably damaging	1.00
IGL01289:Itpr3	APN	17	27099765	missense	probably damaging	0.99
IGL01403:Itpr3	APN	17	27118595	missense	probably damaging	0.97
IGL01666:Itpr3	APN	17	27117178	missense	probably benign	0.02
IGL01897:Itpr3	APN	17	27111262	missense	probably damaging	1.00
IGL02003:Itpr3	APN	17	27121475	missense	probably damaging	1.00
IGL02012:Itpr3	APN	17	27104095	missense	probably benign
IGL02063:Itpr3	APN	17	27120023	missense	probably benign	0.01
IGL02146:Itpr3	APN	17	27117275	missense	probably damaging	1.00
IGL02158:Itpr3	APN	17	27098442	missense	probably damaging	1.00
IGL02177:Itpr3	APN	17	27099614	missense	possibly damaging	0.74
IGL02247:Itpr3	APN	17	27098179	missense	probably damaging	1.00
IGL02606:Itpr3	APN	17	27114512	splice site	probably benign
IGL02651:Itpr3	APN	17	27106398	missense	probably damaging	0.99
IGL02902:Itpr3	APN	17	27104556	missense	probably benign	0.21
IGL03001:Itpr3	APN	17	27089612	splice site	probably benign
IGL03004:Itpr3	APN	17	27097978	missense	possibly damaging	0.90
IGL03065:Itpr3	APN	17	27091933	missense	probably damaging	1.00
IGL03117:Itpr3	APN	17	27119266	missense	probably damaging	1.00
IGL03181:Itpr3	APN	17	27111268	missense	probably benign
IGL03404:Itpr3	APN	17	27091518	missense	probably damaging	1.00
Allure	UTSW	17	27107303	missense	probably damaging	1.00
alopecia	UTSW	17	27095478	missense	probably damaging	0.98
Beauty	UTSW	17	27106342	missense	probably damaging	1.00
Opuesto	UTSW	17	27087592	missense	probably damaging	1.00
Paradox	UTSW	17	27098171	missense	probably damaging	1.00
Pulchritude	UTSW	17	27086960	missense	probably damaging	0.97
R0010:Itpr3	UTSW	17	27120977	missense	probably damaging	1.00
R0055:Itpr3	UTSW	17	27098322	missense	probably damaging	1.00
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0104:Itpr3	UTSW	17	27095992	missense	probably benign	0.01
R0195:Itpr3	UTSW	17	27114114	missense	probably damaging	1.00
R0212:Itpr3	UTSW	17	27089319	missense	probably damaging	1.00
R0454:Itpr3	UTSW	17	27113819	missense	probably benign
R0485:Itpr3	UTSW	17	27111929	missense	probably damaging	0.98
R0501:Itpr3	UTSW	17	27107289	missense	probably benign	0.09
R0781:Itpr3	UTSW	17	27110555	missense	probably benign	0.00
R0890:Itpr3	UTSW	17	27089011	nonsense	probably null
R1028:Itpr3	UTSW	17	27091369	missense	probably benign	0.04
R1144:Itpr3	UTSW	17	27114923	missense	probably benign	0.01
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1458:Itpr3	UTSW	17	27118372	missense	probably benign	0.01
R1463:Itpr3	UTSW	17	27117154	splice site	probably benign
R1472:Itpr3	UTSW	17	27114225	missense	probably benign	0.09
R1529:Itpr3	UTSW	17	27105485	splice site	probably null
R1533:Itpr3	UTSW	17	27095560	missense	possibly damaging	0.71
R1537:Itpr3	UTSW	17	27114147	missense	possibly damaging	0.96
R1618:Itpr3	UTSW	17	27116607	critical splice acceptor site	probably null
R1672:Itpr3	UTSW	17	27089013	missense	probably benign
R1726:Itpr3	UTSW	17	27111690	missense	probably damaging	0.96
R1865:Itpr3	UTSW	17	27120023	missense	probably benign	0.01
R1940:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R2023:Itpr3	UTSW	17	27102811	missense	possibly damaging	0.76
R2063:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2064:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2065:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2067:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2068:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2219:Itpr3	UTSW	17	27115053	missense	probably benign
R2248:Itpr3	UTSW	17	27115059	missense	probably damaging	1.00
R2291:Itpr3	UTSW	17	27113579	missense	possibly damaging	0.92
R2320:Itpr3	UTSW	17	27095915	missense	probably benign
R2864:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R2865:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R3778:Itpr3	UTSW	17	27095472	missense	possibly damaging	0.57
R3881:Itpr3	UTSW	17	27113840	missense	probably benign	0.01
R3979:Itpr3	UTSW	17	27085131	missense	probably benign	0.23
R4224:Itpr3	UTSW	17	27107258	missense	probably damaging	1.00
R4259:Itpr3	UTSW	17	27106324	missense	probably damaging	1.00
R4321:Itpr3	UTSW	17	27111974	missense	probably benign	0.00
R4466:Itpr3	UTSW	17	27106342	missense	probably damaging	1.00
R4493:Itpr3	UTSW	17	27104612	missense	probably damaging	1.00
R4597:Itpr3	UTSW	17	27093283	missense	probably damaging	1.00
R4823:Itpr3	UTSW	17	27085147	missense	probably benign	0.30
R4921:Itpr3	UTSW	17	27098005	missense	probably damaging	1.00
R4974:Itpr3	UTSW	17	27083608	missense	probably damaging	0.96
R5063:Itpr3	UTSW	17	27089911	missense	possibly damaging	0.94
R5079:Itpr3	UTSW	17	27098423	missense	probably damaging	1.00
R5303:Itpr3	UTSW	17	27116689	missense	probably benign	0.38
R5518:Itpr3	UTSW	17	27087592	missense	probably damaging	1.00
R5521:Itpr3	UTSW	17	27107334	missense	probably benign	0.09
R5566:Itpr3	UTSW	17	27115952	missense	possibly damaging	0.71
R5567:Itpr3	UTSW	17	27103906	missense	possibly damaging	0.66
R5579:Itpr3	UTSW	17	27113519	missense	probably damaging	1.00
R5610:Itpr3	UTSW	17	27118566	missense	probably benign	0.42
R5658:Itpr3	UTSW	17	27107878	missense	possibly damaging	0.74
R5856:Itpr3	UTSW	17	27106405	missense	probably damaging	1.00
R5872:Itpr3	UTSW	17	27086976	missense	probably benign	0.02
R5878:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R5889:Itpr3	UTSW	17	27115065	missense	probably damaging	0.99
R5907:Itpr3	UTSW	17	27117893	missense	probably damaging	1.00
R5930:Itpr3	UTSW	17	27110921	missense	possibly damaging	0.49
R5987:Itpr3	UTSW	17	27104601	missense	probably damaging	1.00
R6029:Itpr3	UTSW	17	27098171	missense	probably damaging	1.00
R6195:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6213:Itpr3	UTSW	17	27111200	missense	probably benign	0.03
R6233:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6376:Itpr3	UTSW	17	27095475	missense	possibly damaging	0.94
R6514:Itpr3	UTSW	17	27091370	missense	probably benign
R6515:Itpr3	UTSW	17	27091370	missense	probably benign
R6516:Itpr3	UTSW	17	27091370	missense	probably benign
R6955:Itpr3	UTSW	17	27121467	missense	probably damaging	1.00
R7002:Itpr3	UTSW	17	27110580	missense	probably benign	0.00
R7064:Itpr3	UTSW	17	27089295	missense	probably damaging	1.00
R7257:Itpr3	UTSW	17	27118561	missense	probably benign	0.00
R7349:Itpr3	UTSW	17	27107812	splice site	probably null
R7469:Itpr3	UTSW	17	27121054	missense	possibly damaging	0.74
R7493:Itpr3	UTSW	17	27094800	missense	probably benign	0.09
R7510:Itpr3	UTSW	17	27089039	missense	probably damaging	0.97
R7565:Itpr3	UTSW	17	27110888	missense	probably benign	0.01
R7616:Itpr3	UTSW	17	27088977	missense	probably damaging	1.00
R7728:Itpr3	UTSW	17	27098114	missense	probably damaging	1.00
R7779:Itpr3	UTSW	17	27096063	missense	probably damaging	1.00
R7788:Itpr3	UTSW	17	27118597	nonsense	probably null
R7871:Itpr3	UTSW	17	27117179	missense	probably damaging	1.00
R7889:Itpr3	UTSW	17	27116777	missense	probably damaging	1.00
R7966:Itpr3	UTSW	17	27112028	critical splice donor site	probably null
R8065:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8067:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8230:Itpr3	UTSW	17	27107737	critical splice donor site	probably null
R8263:Itpr3	UTSW	17	27115913	nonsense	probably null
R8264:Itpr3	UTSW	17	27104112	synonymous	silent
R8269:Itpr3	UTSW	17	27093284	missense	possibly damaging	0.60
R8271:Itpr3	UTSW	17	27087648	missense	probably damaging	1.00
R8316:Itpr3	UTSW	17	27106225	missense	possibly damaging	0.50
R8354:Itpr3	UTSW	17	27115919	missense	possibly damaging	0.74
R8413:Itpr3	UTSW	17	27111926	missense	probably damaging	1.00
R8437:Itpr3	UTSW	17	27107303	missense	probably damaging	1.00
R8676:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8679:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8846:Itpr3	UTSW	17	27112022	missense	probably damaging	1.00
R8884:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8885:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8886:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8887:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8888:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8891:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8896:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8975:Itpr3	UTSW	17	27116654	missense	possibly damaging	0.56
R9025:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9026:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9063:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9087:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9088:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9089:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9090:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9091:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9200:Itpr3	UTSW	17	27107662	missense	probably damaging	0.99
R9270:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9271:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9294:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R9389:Itpr3	UTSW	17	27095925	missense	possibly damaging	0.84
R9433:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9434:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9443:Itpr3	UTSW	17	27105549	missense	probably damaging	1.00
R9472:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9474:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9475:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9476:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9477:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9507:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9508:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9511:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9694:Itpr3	UTSW	17	27115953	missense	probably damaging	0.99
R9789:Itpr3	UTSW	17	27089941	missense	probably benign	0.15
V7732:Itpr3	UTSW	17	27111024	splice site	probably benign
V7732:Itpr3	UTSW	17	27111026	splice site	probably null
Z1088:Itpr3	UTSW	17	27113528	missense	possibly damaging	0.50
Z1177:Itpr3	UTSW	17	27114929	missense	probably damaging	1.00
Z1177:Itpr3	UTSW	17	27119987	missense	probably damaging	1.00
Z31818:Itpr3	UTSW	17	27095478	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCATGGTGAGAGCCCTTGTG -3'
(R):5'- CAGCTGGATGACAAACCTGG -3'

Sequencing Primer
(F):5'- AGAGCCCTTGTGCTATATGTG -3'
(R):5'- CCTGGCGAAGGGTAACAC -3'

Posted On

2015-04-29