Mutagenetix > Incidental Mutation

Incidental Mutation 'R3979:Tcof1'

311222

Institutional Source

Beutler Lab

Gene Symbol

Tcof1

Ensembl Gene

ENSMUSG00000024613

Gene Name

treacle ribosome biogenesis factor 1

Synonyms

treacle

MMRRC Submission

040942-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3979 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60813755-60848971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 60831533 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 674 (E674K)

Ref Sequence

ENSEMBL: ENSMUSP00000130454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]

AlphaFold

O08784

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163446
AA Change: E674K

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613
AA Change: E674K

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	322	2.2e-8	PFAM
Pfam:Treacle	321	793	4.6e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	855	874	N/A	INTRINSIC
low complexity region	879	893	N/A	INTRINSIC
low complexity region	916	927	N/A	INTRINSIC
low complexity region	967	977	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175934
AA Change: E674K

SMART Domains

Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: E674K

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	153	329	1.6e-12	PFAM
Pfam:Treacle	321	792	6.1e-175	PFAM
Pfam:Treacle	782	936	3.2e-16	PFAM
low complexity region	969	982	N/A	INTRINSIC
low complexity region	1025	1039	N/A	INTRINSIC
low complexity region	1060	1074	N/A	INTRINSIC
low complexity region	1149	1172	N/A	INTRINSIC
low complexity region	1260	1285	N/A	INTRINSIC
coiled coil region	1306	1335	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176088

Predicted Effect

unknown
Transcript: ENSMUST00000176630
AA Change: E674K

SMART Domains

Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: E674K

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
Pfam:Treacle	108	323	2.5e-8	PFAM
Pfam:Treacle	321	793	5.9e-204	PFAM
low complexity region	819	834	N/A	INTRINSIC
low complexity region	843	857	N/A	INTRINSIC
low complexity region	880	891	N/A	INTRINSIC
low complexity region	933	946	N/A	INTRINSIC
low complexity region	989	1003	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1113	1136	N/A	INTRINSIC
low complexity region	1224	1249	N/A	INTRINSIC
coiled coil region	1270	1299	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000177172
AA Change: E626K

SMART Domains

Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613
AA Change: E626K

Domain	Start	End	E-Value	Type
LisH	6	38	5.09e-4	SMART
low complexity region	75	109	N/A	INTRINSIC
Pfam:Treacle	150	322	1.3e-10	PFAM
Pfam:Treacle	321	506	1.5e-78	PFAM
Pfam:Treacle	498	745	2e-105	PFAM
low complexity region	771	786	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	885	898	N/A	INTRINSIC
low complexity region	941	955	N/A	INTRINSIC
low complexity region	976	990	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,323,976	V82A	probably benign	Het
Adam28	A	G	14: 68,610,994	V671A	probably benign	Het
Ak3	T	A	19: 29,047,718	S38C	probably damaging	Het
Arfgef1	A	G	1: 10,209,634	V236A	probably benign	Het
Arhgap10	T	C	8: 77,420,725	N170S	probably benign	Het
B020004C17Rik	G	T	14: 57,017,188	M156I	possibly damaging	Het
Bicral	T	A	17: 46,830,991	M1L	unknown	Het
Bop1	A	G	15: 76,453,876	L598P	probably damaging	Het
Cachd1	A	T	4: 100,970,888	D611V	probably damaging	Het
Cfap70	T	A	14: 20,439,719	E246D	probably benign	Het
Chl1	T	A	6: 103,715,284	Y294*	probably null	Het
Chrna2	T	A	14: 66,148,953	Y183N	probably damaging	Het
Dab2	A	G	15: 6,435,163		probably null	Het
Dnajb6	T	C	5: 29,751,008	F46L	possibly damaging	Het
Exoc7	T	C	11: 116,296,762	E275G	probably benign	Het
Fam208a	T	C	14: 27,477,130	L1335S	possibly damaging	Het
Frem2	A	G	3: 53,652,070	I1672T	probably benign	Het
Gm12166	T	A	11: 46,052,026	K90M	probably damaging	Het
Gprc6a	C	A	10: 51,621,101	V449L	probably benign	Het
H2-M10.4	A	G	17: 36,461,985	V35A	probably benign	Het
Hr	A	G	14: 70,563,584	T699A	probably benign	Het
Iffo1	A	G	6: 125,160,589		probably benign	Het
Iqgap1	G	A	7: 80,759,934	H218Y	probably damaging	Het
Itpr3	A	C	17: 27,085,131	K109Q	probably benign	Het
Itpr3	A	G	17: 27,091,572	D443G	probably damaging	Het
Katna1	T	C	10: 7,752,754	M249T	probably damaging	Het
Klk1b4	G	A	7: 44,211,593	G220D	probably damaging	Het
Krt24	A	G	11: 99,282,770	C242R	probably benign	Het
Madd	G	A	2: 91,176,828	T313I	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Micalcl	A	G	7: 112,407,678		probably null	Het
Neil3	T	C	8: 53,623,664	T79A	probably damaging	Het
Nras	A	G	3: 103,060,225	I46V	probably benign	Het
Olfr1196	T	C	2: 88,700,448	S294G	probably benign	Het
Olfr1369-ps1	T	A	13: 21,115,861	H56Q	probably benign	Het
Ppfia2	A	G	10: 106,830,629	T399A	possibly damaging	Het
Rarres1	A	G	3: 67,495,810	V86A	probably benign	Het
Rdh19	A	T	10: 127,850,075	R19W	possibly damaging	Het
Rock2	A	G	12: 16,972,736	K1059E	probably damaging	Het
Sparcl1	T	C	5: 104,092,781	H259R	probably benign	Het
Spata31d1c	A	G	13: 65,035,160	D172G	possibly damaging	Het
Stab2	T	C	10: 86,863,456	D515G	possibly damaging	Het
Sycp2l	A	G	13: 41,141,964	I334M	probably damaging	Het
Tas2r103	A	G	6: 133,036,317	L262P	probably benign	Het
Tcaf2	A	G	6: 42,642,547	V182A	probably damaging	Het
Trp63	A	G	16: 25,820,740		probably benign	Het
Ttn	A	T	2: 76,745,394	W25052R	probably damaging	Het
Ubr1	T	A	2: 120,862,687	N1746I	probably benign	Het
Vax2	T	C	6: 83,737,547	V148A	probably damaging	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Vmn2r96	T	A	17: 18,597,679	I698N	probably damaging	Het
Wdr90	A	G	17: 25,859,278	V372A	probably benign	Het
Zfp335	C	T	2: 164,910,638	G62D	probably benign	Het
Zfp563	G	A	17: 33,105,727	R432H	probably benign	Het
Zhx1	T	C	15: 58,053,240	T537A	probably benign	Het

Other mutations in Tcof1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tcof1	APN	18	60814568	unclassified	probably benign
IGL01339:Tcof1	APN	18	60818095	utr 3 prime	probably benign
IGL02072:Tcof1	APN	18	60831565	missense	possibly damaging	0.85
IGL02160:Tcof1	APN	18	60848743	unclassified	probably benign
IGL02513:Tcof1	APN	18	60831778	missense	possibly damaging	0.51
IGL02823:Tcof1	APN	18	60816048	missense	probably benign	0.00
IGL03161:Tcof1	APN	18	60833488	missense	possibly damaging	0.86
IGL03291:Tcof1	APN	18	60829061	missense	possibly damaging	0.71
FR4304:Tcof1	UTSW	18	60835742	unclassified	probably benign
FR4589:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
FR4737:Tcof1	UTSW	18	60828650	critical splice donor site	probably benign
PIT4802001:Tcof1	UTSW	18	60831938	missense	unknown
R0569:Tcof1	UTSW	18	60829035	missense	possibly damaging	0.85
R0602:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R0744:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0782:Tcof1	UTSW	18	60816280	missense	probably damaging	0.97
R0833:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0836:Tcof1	UTSW	18	60845832	missense	probably damaging	1.00
R0885:Tcof1	UTSW	18	60835850	missense	possibly damaging	0.84
R1465:Tcof1	UTSW	18	60818954	splice site	probably benign
R1528:Tcof1	UTSW	18	60814999	nonsense	probably null
R1643:Tcof1	UTSW	18	60816228	missense	possibly damaging	0.72
R1919:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R1920:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R1921:Tcof1	UTSW	18	60838855	missense	possibly damaging	0.87
R2023:Tcof1	UTSW	18	60833533	missense	probably damaging	1.00
R2108:Tcof1	UTSW	18	60835773	missense	probably damaging	0.97
R2114:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2115:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2116:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2117:Tcof1	UTSW	18	60832785	missense	possibly damaging	0.85
R2156:Tcof1	UTSW	18	60831829	missense	possibly damaging	0.92
R2221:Tcof1	UTSW	18	60837901	missense	possibly damaging	0.51
R2229:Tcof1	UTSW	18	60832177	intron	probably benign
R2913:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R2914:Tcof1	UTSW	18	60816084	missense	possibly damaging	0.85
R3944:Tcof1	UTSW	18	60822837	missense	probably damaging	0.98
R4049:Tcof1	UTSW	18	60832903	missense	possibly damaging	0.84
R4125:Tcof1	UTSW	18	60819601	missense	unknown
R5047:Tcof1	UTSW	18	60831914	missense	possibly damaging	0.86
R5433:Tcof1	UTSW	18	60818033	utr 3 prime	probably benign
R5546:Tcof1	UTSW	18	60831556	missense	possibly damaging	0.85
R5832:Tcof1	UTSW	18	60819539	missense	unknown
R5965:Tcof1	UTSW	18	60833418	critical splice donor site	probably null
R6301:Tcof1	UTSW	18	60828825	missense	probably damaging	0.97
R6480:Tcof1	UTSW	18	60814780	splice site	probably null
R6910:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R6911:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7105:Tcof1	UTSW	18	60843296	missense	probably damaging	1.00
R7225:Tcof1	UTSW	18	60828448	missense	unknown
R7356:Tcof1	UTSW	18	60818094	missense	unknown
R7467:Tcof1	UTSW	18	60831905	missense	unknown
R7536:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7804:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7818:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R7863:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8006:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8007:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8008:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8063:Tcof1	UTSW	18	60838762	missense	probably damaging	1.00
R8192:Tcof1	UTSW	18	60843303	missense	probably damaging	1.00
R8200:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8203:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8204:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8207:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8217:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8300:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8517:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8518:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8553:Tcof1	UTSW	18	60831571	missense	possibly damaging	0.92
R8729:Tcof1	UTSW	18	60829073	missense	unknown
R8732:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R8749:Tcof1	UTSW	18	60829051	missense	possibly damaging	0.84
R9800:Tcof1	UTSW	18	60816486	missense	unknown
RF001:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF007:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF009:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF010:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF011:Tcof1	UTSW	18	60835739	unclassified	probably benign
RF013:Tcof1	UTSW	18	60835743	unclassified	probably benign
RF015:Tcof1	UTSW	18	60833584	small insertion	probably benign
RF016:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF022:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF024:Tcof1	UTSW	18	60835738	unclassified	probably benign
RF027:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835735	unclassified	probably benign
RF029:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF030:Tcof1	UTSW	18	60833568	small insertion	probably benign
RF030:Tcof1	UTSW	18	60833574	small insertion	probably benign
RF030:Tcof1	UTSW	18	60835723	unclassified	probably benign
RF031:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF031:Tcof1	UTSW	18	60835745	unclassified	probably benign
RF035:Tcof1	UTSW	18	60833553	small insertion	probably benign
RF036:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF036:Tcof1	UTSW	18	60835736	unclassified	probably benign
RF038:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF040:Tcof1	UTSW	18	60828408	small insertion	probably benign
RF040:Tcof1	UTSW	18	60833583	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF041:Tcof1	UTSW	18	60833576	small insertion	probably benign
RF043:Tcof1	UTSW	18	60833572	small insertion	probably benign
RF050:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF051:Tcof1	UTSW	18	60833579	small insertion	probably benign
RF053:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF056:Tcof1	UTSW	18	60833575	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833564	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833565	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833566	small insertion	probably benign
RF057:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF060:Tcof1	UTSW	18	60835744	unclassified	probably benign
RF060:Tcof1	UTSW	18	60835747	unclassified	probably benign
RF063:Tcof1	UTSW	18	60833573	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833571	small insertion	probably benign
RF064:Tcof1	UTSW	18	60833574	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTAGGAACCTAGAGCCAGG -3'
(R):5'- TTACCCAGGTAGGCTCACTC -3'

Sequencing Primer
(F):5'- CCAGGGGGCTCAGGAAAC -3'
(R):5'- GCATCTCTGGCCCTTGAGAAAC -3'

Posted On

2015-04-29