Incidental Mutation 'R3980:Rapgef1'
ID311230
Institutional Source Beutler Lab
Gene Symbol Rapgef1
Ensembl Gene ENSMUSG00000039844
Gene NameRap guanine nucleotide exchange factor (GEF) 1
SynonymsGrf2, 4932418O06Rik, C3G
MMRRC Submission 040843-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3980 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29619720-29740978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29719650 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 700 (V700I)
Ref Sequence ENSEMBL: ENSMUSP00000092703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]
Predicted Effect probably benign
Transcript: ENSMUST00000091146
AA Change: V662I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: V662I

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 689 700 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
RasGEFN 828 970 8.04e-37 SMART
RasGEF 977 1206 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095087
AA Change: V700I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: V700I

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 702 720 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
RasGEFN 834 976 8.04e-37 SMART
RasGEF 983 1212 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102872
SMART Domains Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
RasGEFN 696 838 8.04e-37 SMART
RasGEF 845 1074 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147488
SMART Domains Protein: ENSMUSP00000117631
Gene: ENSMUSG00000039844

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
RasGEFN 253 395 8.04e-37 SMART
RasGEF 402 631 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147755
AA Change: V661I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844
AA Change: V661I

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
low complexity region 663 681 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,582,943 G268R probably damaging Het
Amacr T A 15: 10,988,929 Y240* probably null Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Arhgef25 C A 10: 127,187,220 C106F probably damaging Het
Bean1 A T 8: 104,211,098 Q103L possibly damaging Het
Ccr9 A T 9: 123,779,376 N41I probably benign Het
Ceacam16 A G 7: 19,858,633 F117L probably benign Het
Col4a1 T C 8: 11,239,155 probably benign Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Csmd1 T A 8: 15,906,056 K3384* probably null Het
Ctnnd2 T A 15: 30,669,443 H399Q probably benign Het
Cutal T C 2: 34,882,313 Y30H possibly damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Defb30 C A 14: 63,035,972 C64F probably damaging Het
Eif2a T C 3: 58,539,539 I45T probably benign Het
Esyt1 T A 10: 128,511,524 D1044V probably damaging Het
Fam196b G A 11: 34,402,678 C240Y probably benign Het
Gabpb2 A T 3: 95,188,770 V382E probably damaging Het
Glb1 T A 9: 114,417,064 I61K probably damaging Het
Kcnt1 T C 2: 25,893,214 V263A possibly damaging Het
Kdm5b A G 1: 134,619,670 D1019G probably benign Het
Klhl2 A T 8: 64,743,075 L545M probably damaging Het
Klhl2 C A 8: 64,743,081 G543C probably damaging Het
Krt31 G T 11: 100,048,204 Q264K probably damaging Het
Lmnb1 A G 18: 56,731,019 D232G probably damaging Het
Loxhd1 T C 18: 77,414,159 F859L probably damaging Het
Map7 C A 10: 20,267,353 T416K unknown Het
Med18 T A 4: 132,462,940 I45F probably benign Het
Mn1 A T 5: 111,421,770 H1202L possibly damaging Het
Mpp7 T C 18: 7,444,062 D120G probably benign Het
Nlrp1b A T 11: 71,181,611 F469I possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Nrap G A 19: 56,381,552 A206V probably benign Het
Nuggc T C 14: 65,619,093 probably null Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr1335 T A 4: 118,809,303 Y187F probably benign Het
Olfr559 T C 7: 102,723,752 N246S probably damaging Het
Parp3 T C 9: 106,474,068 D278G probably damaging Het
Phc3 T A 3: 30,936,931 Q346L probably damaging Het
Pigo A G 4: 43,019,231 L1029P probably damaging Het
Plcb3 A G 19: 6,966,435 I66T probably damaging Het
Plch2 T C 4: 154,984,798 S1019G probably benign Het
Plekhg6 C A 6: 125,373,183 C264F probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pou4f2 G T 8: 78,435,438 H179N possibly damaging Het
Prpf39 T C 12: 65,061,457 probably benign Het
Rdh14 A G 12: 10,394,703 I185V probably benign Het
Rnf111 A T 9: 70,442,325 H785Q probably damaging Het
Rttn C T 18: 89,017,275 R758W probably benign Het
Sik3 G A 9: 46,202,063 V601M probably damaging Het
Slc22a14 T C 9: 119,178,486 T286A probably benign Het
Slc36a3 G A 11: 55,135,383 T203I probably benign Het
Spata31 A T 13: 64,922,654 Q872L probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Sphkap A T 1: 83,267,494 probably null Het
Stat6 T C 10: 127,655,379 V463A probably damaging Het
Stx7 T C 10: 24,185,049 S225P probably damaging Het
Sult2a7 A T 7: 14,473,409 probably benign Het
Tada2a A T 11: 84,103,120 F179L probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tfap2d A G 1: 19,165,963 I382V possibly damaging Het
Tshr C A 12: 91,537,743 A485D probably damaging Het
Vmn1r32 T A 6: 66,553,714 Y26F probably damaging Het
Vmn1r5 A G 6: 56,985,651 T104A probably damaging Het
Wbp1l T A 19: 46,653,957 probably null Het
Other mutations in Rapgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Rapgef1 APN 2 29722269 missense probably benign
IGL00917:Rapgef1 APN 2 29702523 missense probably benign 0.00
IGL02618:Rapgef1 APN 2 29737943 missense probably damaging 1.00
IGL02642:Rapgef1 APN 2 29700860 splice site probably benign
IGL02974:Rapgef1 APN 2 29710216 missense possibly damaging 0.64
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0279:Rapgef1 UTSW 2 29726227 missense probably damaging 1.00
R0432:Rapgef1 UTSW 2 29679816 missense possibly damaging 0.86
R1817:Rapgef1 UTSW 2 29686256 missense probably damaging 1.00
R1837:Rapgef1 UTSW 2 29737426 missense probably damaging 1.00
R1970:Rapgef1 UTSW 2 29733711 missense probably damaging 1.00
R1980:Rapgef1 UTSW 2 29722227 missense probably benign
R2076:Rapgef1 UTSW 2 29702508 missense probably benign 0.00
R2363:Rapgef1 UTSW 2 29736596 missense possibly damaging 0.63
R3016:Rapgef1 UTSW 2 29707393 missense probably damaging 1.00
R3053:Rapgef1 UTSW 2 29724856 missense probably damaging 1.00
R3777:Rapgef1 UTSW 2 29719689 missense possibly damaging 0.67
R4491:Rapgef1 UTSW 2 29719656 missense possibly damaging 0.93
R4524:Rapgef1 UTSW 2 29679246 missense probably benign 0.00
R4732:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R4733:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R5391:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5395:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5611:Rapgef1 UTSW 2 29702436 missense probably damaging 0.96
R6062:Rapgef1 UTSW 2 29700732 missense probably damaging 0.96
R6145:Rapgef1 UTSW 2 29736666 missense probably damaging 1.00
R6580:Rapgef1 UTSW 2 29730609 missense possibly damaging 0.95
R6892:Rapgef1 UTSW 2 29699840 critical splice donor site probably null
R6897:Rapgef1 UTSW 2 29702502 missense probably damaging 1.00
R6957:Rapgef1 UTSW 2 29733698 missense possibly damaging 0.62
R7039:Rapgef1 UTSW 2 29726214 missense probably damaging 0.97
R7149:Rapgef1 UTSW 2 29720700 missense probably damaging 0.98
R7253:Rapgef1 UTSW 2 29699721 missense possibly damaging 0.72
R7315:Rapgef1 UTSW 2 29734492 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATAGGACACACCAGCCATG -3'
(R):5'- TTCTAAAACCCTGCAGGCC -3'

Sequencing Primer
(F):5'- CCTGGGTTCTGTAGTACA -3'
(R):5'- GTGCTGAATTCTCACCGAGTCAG -3'
Posted On2015-04-29