Incidental Mutation 'R3980:Sult2a7'
ID311248
Institutional Source Beutler Lab
Gene Symbol Sult2a7
Ensembl Gene ENSMUSG00000094156
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 7
SynonymsGm7231
MMRRC Submission 040843-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3980 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location14465051-14494230 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 14473409 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108524] [ENSMUST00000209744] [ENSMUST00000210034] [ENSMUST00000211740]
Predicted Effect unknown
Transcript: ENSMUST00000108524
AA Change: V182D
SMART Domains Protein: ENSMUSP00000104164
Gene: ENSMUSG00000094156
AA Change: V182D

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 18 176 2.7e-48 PFAM
Pfam:Sulfotransfer_1 198 291 4.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209744
Predicted Effect probably benign
Transcript: ENSMUST00000210034
Predicted Effect unknown
Transcript: ENSMUST00000211740
AA Change: V197D
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,582,943 G268R probably damaging Het
Amacr T A 15: 10,988,929 Y240* probably null Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Arhgef25 C A 10: 127,187,220 C106F probably damaging Het
Bean1 A T 8: 104,211,098 Q103L possibly damaging Het
Ccr9 A T 9: 123,779,376 N41I probably benign Het
Ceacam16 A G 7: 19,858,633 F117L probably benign Het
Col4a1 T C 8: 11,239,155 probably benign Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Csmd1 T A 8: 15,906,056 K3384* probably null Het
Ctnnd2 T A 15: 30,669,443 H399Q probably benign Het
Cutal T C 2: 34,882,313 Y30H possibly damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Defb30 C A 14: 63,035,972 C64F probably damaging Het
Eif2a T C 3: 58,539,539 I45T probably benign Het
Esyt1 T A 10: 128,511,524 D1044V probably damaging Het
Fam196b G A 11: 34,402,678 C240Y probably benign Het
Gabpb2 A T 3: 95,188,770 V382E probably damaging Het
Glb1 T A 9: 114,417,064 I61K probably damaging Het
Kcnt1 T C 2: 25,893,214 V263A possibly damaging Het
Kdm5b A G 1: 134,619,670 D1019G probably benign Het
Klhl2 A T 8: 64,743,075 L545M probably damaging Het
Klhl2 C A 8: 64,743,081 G543C probably damaging Het
Krt31 G T 11: 100,048,204 Q264K probably damaging Het
Lmnb1 A G 18: 56,731,019 D232G probably damaging Het
Loxhd1 T C 18: 77,414,159 F859L probably damaging Het
Map7 C A 10: 20,267,353 T416K unknown Het
Med18 T A 4: 132,462,940 I45F probably benign Het
Mn1 A T 5: 111,421,770 H1202L possibly damaging Het
Mpp7 T C 18: 7,444,062 D120G probably benign Het
Nlrp1b A T 11: 71,181,611 F469I possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Nrap G A 19: 56,381,552 A206V probably benign Het
Nuggc T C 14: 65,619,093 probably null Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr1335 T A 4: 118,809,303 Y187F probably benign Het
Olfr559 T C 7: 102,723,752 N246S probably damaging Het
Parp3 T C 9: 106,474,068 D278G probably damaging Het
Phc3 T A 3: 30,936,931 Q346L probably damaging Het
Pigo A G 4: 43,019,231 L1029P probably damaging Het
Plcb3 A G 19: 6,966,435 I66T probably damaging Het
Plch2 T C 4: 154,984,798 S1019G probably benign Het
Plekhg6 C A 6: 125,373,183 C264F probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pou4f2 G T 8: 78,435,438 H179N possibly damaging Het
Prpf39 T C 12: 65,061,457 probably benign Het
Rapgef1 G A 2: 29,719,650 V700I probably benign Het
Rdh14 A G 12: 10,394,703 I185V probably benign Het
Rnf111 A T 9: 70,442,325 H785Q probably damaging Het
Rttn C T 18: 89,017,275 R758W probably benign Het
Sik3 G A 9: 46,202,063 V601M probably damaging Het
Slc22a14 T C 9: 119,178,486 T286A probably benign Het
Slc36a3 G A 11: 55,135,383 T203I probably benign Het
Spata31 A T 13: 64,922,654 Q872L probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Sphkap A T 1: 83,267,494 probably null Het
Stat6 T C 10: 127,655,379 V463A probably damaging Het
Stx7 T C 10: 24,185,049 S225P probably damaging Het
Tada2a A T 11: 84,103,120 F179L probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tfap2d A G 1: 19,165,963 I382V possibly damaging Het
Tshr C A 12: 91,537,743 A485D probably damaging Het
Vmn1r32 T A 6: 66,553,714 Y26F probably damaging Het
Vmn1r5 A G 6: 56,985,651 T104A probably damaging Het
Wbp1l T A 19: 46,653,957 probably null Het
Other mutations in Sult2a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Sult2a7 APN 7 14491723 missense probably benign 0.00
R0052:Sult2a7 UTSW 7 14465208 missense probably damaging 1.00
R1547:Sult2a7 UTSW 7 14477122 critical splice acceptor site probably null
R2012:Sult2a7 UTSW 7 14473397 intron probably benign
R2255:Sult2a7 UTSW 7 14491893 missense probably damaging 1.00
R4509:Sult2a7 UTSW 7 14470161 missense probably damaging 1.00
R6147:Sult2a7 UTSW 7 14465163 missense probably damaging 0.99
R7186:Sult2a7 UTSW 7 14470053 missense not run
R7356:Sult2a7 UTSW 7 14477106 missense probably damaging 1.00
R7899:Sult2a7 UTSW 7 14465209 missense probably damaging 1.00
R7982:Sult2a7 UTSW 7 14465209 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTCTCAGCCATTAAAGACAACA -3'
(R):5'- GGCTTCCATGTAAGCTCTTGG -3'

Sequencing Primer
(F):5'- TGGATACAGTGGTCAAAGAAAATG -3'
(R):5'- TCCATGTAAGCTCTTGGGCCAAG -3'
Posted On2015-04-29