Incidental Mutation 'R3980:Pou4f2'
ID311256
Institutional Source Beutler Lab
Gene Symbol Pou4f2
Ensembl Gene ENSMUSG00000031688
Gene NamePOU domain, class 4, transcription factor 2
SynonymsPou4f-rs1, Brn-3.2, Brn3b, mBrn3-3R, Brn-3b
MMRRC Submission 040843-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3980 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location78433010-78436645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78435438 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 179 (H179N)
Ref Sequence ENSEMBL: ENSMUSP00000034115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034115]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034115
AA Change: H179N

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034115
Gene: ENSMUSG00000031688
AA Change: H179N

DomainStartEndE-ValueType
low complexity region 31 86 N/A INTRINSIC
low complexity region 109 118 N/A INTRINSIC
low complexity region 127 137 N/A INTRINSIC
low complexity region 151 168 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
POU 252 329 1.33e-51 SMART
HOX 347 409 3.31e-18 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the POU-domain transcription factor family and may be involved in maintaining visual system neurons in the retina. The level of the encoded protein is also elevated in a majority of breast cancers, resulting in accelerated tumor growth. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygote null mice have a 70% reduction in retinal ganglion cells, a thin retina, and an optic nerve with a decreased diameter and disorganized axons. Eyes have miotic pupils and defective optokinetic reflexes that prevent photo-entrainment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,582,943 G268R probably damaging Het
Amacr T A 15: 10,988,929 Y240* probably null Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Arhgef25 C A 10: 127,187,220 C106F probably damaging Het
Bean1 A T 8: 104,211,098 Q103L possibly damaging Het
Ccr9 A T 9: 123,779,376 N41I probably benign Het
Ceacam16 A G 7: 19,858,633 F117L probably benign Het
Col4a1 T C 8: 11,239,155 probably benign Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Csmd1 T A 8: 15,906,056 K3384* probably null Het
Ctnnd2 T A 15: 30,669,443 H399Q probably benign Het
Cutal T C 2: 34,882,313 Y30H possibly damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Defb30 C A 14: 63,035,972 C64F probably damaging Het
Eif2a T C 3: 58,539,539 I45T probably benign Het
Esyt1 T A 10: 128,511,524 D1044V probably damaging Het
Fam196b G A 11: 34,402,678 C240Y probably benign Het
Gabpb2 A T 3: 95,188,770 V382E probably damaging Het
Glb1 T A 9: 114,417,064 I61K probably damaging Het
Kcnt1 T C 2: 25,893,214 V263A possibly damaging Het
Kdm5b A G 1: 134,619,670 D1019G probably benign Het
Klhl2 A T 8: 64,743,075 L545M probably damaging Het
Klhl2 C A 8: 64,743,081 G543C probably damaging Het
Krt31 G T 11: 100,048,204 Q264K probably damaging Het
Lmnb1 A G 18: 56,731,019 D232G probably damaging Het
Loxhd1 T C 18: 77,414,159 F859L probably damaging Het
Map7 C A 10: 20,267,353 T416K unknown Het
Med18 T A 4: 132,462,940 I45F probably benign Het
Mn1 A T 5: 111,421,770 H1202L possibly damaging Het
Mpp7 T C 18: 7,444,062 D120G probably benign Het
Nlrp1b A T 11: 71,181,611 F469I possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Nrap G A 19: 56,381,552 A206V probably benign Het
Nuggc T C 14: 65,619,093 probably null Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr1335 T A 4: 118,809,303 Y187F probably benign Het
Olfr559 T C 7: 102,723,752 N246S probably damaging Het
Parp3 T C 9: 106,474,068 D278G probably damaging Het
Phc3 T A 3: 30,936,931 Q346L probably damaging Het
Pigo A G 4: 43,019,231 L1029P probably damaging Het
Plcb3 A G 19: 6,966,435 I66T probably damaging Het
Plch2 T C 4: 154,984,798 S1019G probably benign Het
Plekhg6 C A 6: 125,373,183 C264F probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Prpf39 T C 12: 65,061,457 probably benign Het
Rapgef1 G A 2: 29,719,650 V700I probably benign Het
Rdh14 A G 12: 10,394,703 I185V probably benign Het
Rnf111 A T 9: 70,442,325 H785Q probably damaging Het
Rttn C T 18: 89,017,275 R758W probably benign Het
Sik3 G A 9: 46,202,063 V601M probably damaging Het
Slc22a14 T C 9: 119,178,486 T286A probably benign Het
Slc36a3 G A 11: 55,135,383 T203I probably benign Het
Spata31 A T 13: 64,922,654 Q872L probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Sphkap A T 1: 83,267,494 probably null Het
Stat6 T C 10: 127,655,379 V463A probably damaging Het
Stx7 T C 10: 24,185,049 S225P probably damaging Het
Sult2a7 A T 7: 14,473,409 probably benign Het
Tada2a A T 11: 84,103,120 F179L probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tfap2d A G 1: 19,165,963 I382V possibly damaging Het
Tshr C A 12: 91,537,743 A485D probably damaging Het
Vmn1r32 T A 6: 66,553,714 Y26F probably damaging Het
Vmn1r5 A G 6: 56,985,651 T104A probably damaging Het
Wbp1l T A 19: 46,653,957 probably null Het
Other mutations in Pou4f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Pou4f2 APN 8 78435105 missense probably damaging 0.99
IGL01578:Pou4f2 APN 8 78435655 missense probably damaging 1.00
IGL02750:Pou4f2 APN 8 78435063 missense probably damaging 1.00
R0538:Pou4f2 UTSW 8 78435662 missense probably damaging 1.00
R0597:Pou4f2 UTSW 8 78435240 missense probably benign 0.00
R1328:Pou4f2 UTSW 8 78436130 missense probably benign 0.01
R1680:Pou4f2 UTSW 8 78434831 missense probably damaging 1.00
R2376:Pou4f2 UTSW 8 78436185 missense unknown
R4770:Pou4f2 UTSW 8 78436401 missense unknown
R4771:Pou4f2 UTSW 8 78435236 missense possibly damaging 0.67
R5288:Pou4f2 UTSW 8 78436329 missense unknown
R5395:Pou4f2 UTSW 8 78435072 missense probably damaging 1.00
R5930:Pou4f2 UTSW 8 78436391 missense unknown
R6036:Pou4f2 UTSW 8 78435474 missense probably damaging 0.96
R6036:Pou4f2 UTSW 8 78435474 missense probably damaging 0.96
R6883:Pou4f2 UTSW 8 78435678 missense probably benign 0.01
R7300:Pou4f2 UTSW 8 78436106 splice site probably null
Z1088:Pou4f2 UTSW 8 78435601 missense probably benign 0.00
Z1177:Pou4f2 UTSW 8 78435180 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGCGTCGCTGCTTGAAAC -3'
(R):5'- GACATCGTCTCCCAGAGTAAGAG -3'

Sequencing Primer
(F):5'- ATCCACGTCGCTCATGCAG -3'
(R):5'- GTCTCCCAGAGTAAGAGCCACC -3'
Posted On2015-04-29