Incidental Mutation 'R3980:Csk'
ID311259
Institutional Source Beutler Lab
Gene Symbol Csk
Ensembl Gene ENSMUSG00000032312
Gene Namec-src tyrosine kinase
Synonyms
MMRRC Submission 040843-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3980 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57626646-57653631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57630780 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 48 (Y48H)
Ref Sequence ENSEMBL: ENSMUSP00000150984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034863] [ENSMUST00000215396] [ENSMUST00000216934] [ENSMUST00000216979] [ENSMUST00000217128] [ENSMUST00000217314]
Predicted Effect probably damaging
Transcript: ENSMUST00000034863
AA Change: Y48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034863
Gene: ENSMUSG00000032312
AA Change: Y48H

DomainStartEndE-ValueType
SH3 12 69 1.09e-17 SMART
SH2 80 162 1.96e-35 SMART
TyrKc 195 440 2.37e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213660
Predicted Effect probably damaging
Transcript: ENSMUST00000215396
AA Change: Y48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215958
Predicted Effect probably damaging
Transcript: ENSMUST00000216934
AA Change: Y48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216979
AA Change: Y48H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217128
AA Change: Y48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217314
AA Change: Y48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit growth retardation, neural tube defects, and developmental arrest at the 10-12 somite stage. Mutants die between embryonic days nine and ten. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,582,943 G268R probably damaging Het
Amacr T A 15: 10,988,929 Y240* probably null Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Arhgef25 C A 10: 127,187,220 C106F probably damaging Het
Bean1 A T 8: 104,211,098 Q103L possibly damaging Het
Ccr9 A T 9: 123,779,376 N41I probably benign Het
Ceacam16 A G 7: 19,858,633 F117L probably benign Het
Col4a1 T C 8: 11,239,155 probably benign Het
Csmd1 T A 8: 15,906,056 K3384* probably null Het
Ctnnd2 T A 15: 30,669,443 H399Q probably benign Het
Cutal T C 2: 34,882,313 Y30H possibly damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Defb30 C A 14: 63,035,972 C64F probably damaging Het
Eif2a T C 3: 58,539,539 I45T probably benign Het
Esyt1 T A 10: 128,511,524 D1044V probably damaging Het
Fam196b G A 11: 34,402,678 C240Y probably benign Het
Gabpb2 A T 3: 95,188,770 V382E probably damaging Het
Glb1 T A 9: 114,417,064 I61K probably damaging Het
Kcnt1 T C 2: 25,893,214 V263A possibly damaging Het
Kdm5b A G 1: 134,619,670 D1019G probably benign Het
Klhl2 A T 8: 64,743,075 L545M probably damaging Het
Klhl2 C A 8: 64,743,081 G543C probably damaging Het
Krt31 G T 11: 100,048,204 Q264K probably damaging Het
Lmnb1 A G 18: 56,731,019 D232G probably damaging Het
Loxhd1 T C 18: 77,414,159 F859L probably damaging Het
Map7 C A 10: 20,267,353 T416K unknown Het
Med18 T A 4: 132,462,940 I45F probably benign Het
Mn1 A T 5: 111,421,770 H1202L possibly damaging Het
Mpp7 T C 18: 7,444,062 D120G probably benign Het
Nlrp1b A T 11: 71,181,611 F469I possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Nrap G A 19: 56,381,552 A206V probably benign Het
Nuggc T C 14: 65,619,093 probably null Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr1335 T A 4: 118,809,303 Y187F probably benign Het
Olfr559 T C 7: 102,723,752 N246S probably damaging Het
Parp3 T C 9: 106,474,068 D278G probably damaging Het
Phc3 T A 3: 30,936,931 Q346L probably damaging Het
Pigo A G 4: 43,019,231 L1029P probably damaging Het
Plcb3 A G 19: 6,966,435 I66T probably damaging Het
Plch2 T C 4: 154,984,798 S1019G probably benign Het
Plekhg6 C A 6: 125,373,183 C264F probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pou4f2 G T 8: 78,435,438 H179N possibly damaging Het
Prpf39 T C 12: 65,061,457 probably benign Het
Rapgef1 G A 2: 29,719,650 V700I probably benign Het
Rdh14 A G 12: 10,394,703 I185V probably benign Het
Rnf111 A T 9: 70,442,325 H785Q probably damaging Het
Rttn C T 18: 89,017,275 R758W probably benign Het
Sik3 G A 9: 46,202,063 V601M probably damaging Het
Slc22a14 T C 9: 119,178,486 T286A probably benign Het
Slc36a3 G A 11: 55,135,383 T203I probably benign Het
Spata31 A T 13: 64,922,654 Q872L probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Sphkap A T 1: 83,267,494 probably null Het
Stat6 T C 10: 127,655,379 V463A probably damaging Het
Stx7 T C 10: 24,185,049 S225P probably damaging Het
Sult2a7 A T 7: 14,473,409 probably benign Het
Tada2a A T 11: 84,103,120 F179L probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tfap2d A G 1: 19,165,963 I382V possibly damaging Het
Tshr C A 12: 91,537,743 A485D probably damaging Het
Vmn1r32 T A 6: 66,553,714 Y26F probably damaging Het
Vmn1r5 A G 6: 56,985,651 T104A probably damaging Het
Wbp1l T A 19: 46,653,957 probably null Het
Other mutations in Csk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Csk APN 9 57629021 missense probably damaging 1.00
IGL02558:Csk APN 9 57630263 missense probably benign
IGL02723:Csk APN 9 57631389 utr 5 prime probably benign
clorets UTSW 9 57630302 missense probably benign 0.03
R0349:Csk UTSW 9 57628194 missense probably damaging 0.98
R1553:Csk UTSW 9 57630942 missense probably damaging 1.00
R3196:Csk UTSW 9 57630273 nonsense probably null
R4912:Csk UTSW 9 57630780 missense probably damaging 1.00
R5231:Csk UTSW 9 57630378 missense probably damaging 1.00
R5574:Csk UTSW 9 57629301 missense probably benign 0.00
R5894:Csk UTSW 9 57628675 missense probably damaging 0.99
R5898:Csk UTSW 9 57630302 missense probably benign 0.03
R7542:Csk UTSW 9 57629000 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGATGCCTTTCCAGGAGGAC -3'
(R):5'- CCGGTACAGAATGTATTGCCAAG -3'

Sequencing Primer
(F):5'- TTTCCAGGAGGACCACGG -3'
(R):5'- AACTTCCATGGCACTGCTGAG -3'
Posted On2015-04-29