Incidental Mutation 'R3980:Nlrp1b'
ID311273
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene NameNLR family, pyrin domain containing 1B
SynonymsNalp1b
MMRRC Submission 040843-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3980 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location71153102-71230733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71181611 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 469 (F469I)
Ref Sequence ENSEMBL: ENSMUSP00000104155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108514] [ENSMUST00000108515] [ENSMUST00000108516] [ENSMUST00000136493]
Predicted Effect probably benign
Transcript: ENSMUST00000094046
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108514
AA Change: F469I

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104154
Gene: ENSMUSG00000070390
AA Change: F469I

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.1e-40 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 814 1068 2.4e-136 PFAM
Pfam:CARD 1086 1169 3.7e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108515
AA Change: F469I

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104155
Gene: ENSMUSG00000070390
AA Change: F469I

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.9e-41 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 815 1067 5e-104 PFAM
Pfam:CARD 1086 1169 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108516
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,582,943 G268R probably damaging Het
Amacr T A 15: 10,988,929 Y240* probably null Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Arhgef25 C A 10: 127,187,220 C106F probably damaging Het
Bean1 A T 8: 104,211,098 Q103L possibly damaging Het
Ccr9 A T 9: 123,779,376 N41I probably benign Het
Ceacam16 A G 7: 19,858,633 F117L probably benign Het
Col4a1 T C 8: 11,239,155 probably benign Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Csmd1 T A 8: 15,906,056 K3384* probably null Het
Ctnnd2 T A 15: 30,669,443 H399Q probably benign Het
Cutal T C 2: 34,882,313 Y30H possibly damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Defb30 C A 14: 63,035,972 C64F probably damaging Het
Eif2a T C 3: 58,539,539 I45T probably benign Het
Esyt1 T A 10: 128,511,524 D1044V probably damaging Het
Fam196b G A 11: 34,402,678 C240Y probably benign Het
Gabpb2 A T 3: 95,188,770 V382E probably damaging Het
Glb1 T A 9: 114,417,064 I61K probably damaging Het
Kcnt1 T C 2: 25,893,214 V263A possibly damaging Het
Kdm5b A G 1: 134,619,670 D1019G probably benign Het
Klhl2 A T 8: 64,743,075 L545M probably damaging Het
Klhl2 C A 8: 64,743,081 G543C probably damaging Het
Krt31 G T 11: 100,048,204 Q264K probably damaging Het
Lmnb1 A G 18: 56,731,019 D232G probably damaging Het
Loxhd1 T C 18: 77,414,159 F859L probably damaging Het
Map7 C A 10: 20,267,353 T416K unknown Het
Med18 T A 4: 132,462,940 I45F probably benign Het
Mn1 A T 5: 111,421,770 H1202L possibly damaging Het
Mpp7 T C 18: 7,444,062 D120G probably benign Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Nrap G A 19: 56,381,552 A206V probably benign Het
Nuggc T C 14: 65,619,093 probably null Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr1335 T A 4: 118,809,303 Y187F probably benign Het
Olfr559 T C 7: 102,723,752 N246S probably damaging Het
Parp3 T C 9: 106,474,068 D278G probably damaging Het
Phc3 T A 3: 30,936,931 Q346L probably damaging Het
Pigo A G 4: 43,019,231 L1029P probably damaging Het
Plcb3 A G 19: 6,966,435 I66T probably damaging Het
Plch2 T C 4: 154,984,798 S1019G probably benign Het
Plekhg6 C A 6: 125,373,183 C264F probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pou4f2 G T 8: 78,435,438 H179N possibly damaging Het
Prpf39 T C 12: 65,061,457 probably benign Het
Rapgef1 G A 2: 29,719,650 V700I probably benign Het
Rdh14 A G 12: 10,394,703 I185V probably benign Het
Rnf111 A T 9: 70,442,325 H785Q probably damaging Het
Rttn C T 18: 89,017,275 R758W probably benign Het
Sik3 G A 9: 46,202,063 V601M probably damaging Het
Slc22a14 T C 9: 119,178,486 T286A probably benign Het
Slc36a3 G A 11: 55,135,383 T203I probably benign Het
Spata31 A T 13: 64,922,654 Q872L probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Sphkap A T 1: 83,267,494 probably null Het
Stat6 T C 10: 127,655,379 V463A probably damaging Het
Stx7 T C 10: 24,185,049 S225P probably damaging Het
Sult2a7 A T 7: 14,473,409 probably benign Het
Tada2a A T 11: 84,103,120 F179L probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tfap2d A G 1: 19,165,963 I382V possibly damaging Het
Tshr C A 12: 91,537,743 A485D probably damaging Het
Vmn1r32 T A 6: 66,553,714 Y26F probably damaging Het
Vmn1r5 A G 6: 56,985,651 T104A probably damaging Het
Wbp1l T A 19: 46,653,957 probably null Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
androcles UTSW 11 71172075 nonsense probably null
Fangled UTSW 11 71172171 missense possibly damaging 0.94
glitz UTSW 11 71181550 missense possibly damaging 0.89
honeydew UTSW 11 71217884 missense possibly damaging 0.93
Mush UTSW 11 71156079 missense probably damaging 1.00
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71182811 missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71155989 splice site probably benign
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71218334 missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71217276 missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71156079 missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71172075 nonsense probably null
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
R7349:Nlrp1b UTSW 11 71182117 missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71181550 missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71168839 missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R7994:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R8031:Nlrp1b UTSW 11 71216921 missense probably benign 0.15
Z1176:Nlrp1b UTSW 11 71182270 missense probably damaging 1.00
Z1177:Nlrp1b UTSW 11 71181299 nonsense probably null
Z1177:Nlrp1b UTSW 11 71217224 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTTCCTTGAAGATCATGCATCAC -3'
(R):5'- TCAAAAGCAGGCCAGCTCTC -3'

Sequencing Primer
(F):5'- GCATCACATGTGTCAGGAGCTTC -3'
(R):5'- CTCCAGGAGTTCTTTGCA -3'
Posted On2015-04-29