Incidental Mutation 'R3980:Prpf39'
ID311280
Institutional Source Beutler Lab
Gene Symbol Prpf39
Ensembl Gene ENSMUSG00000035597
Gene Namepre-mRNA processing factor 39
SynonymsSrcs1
MMRRC Submission 040843-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R3980 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location65036333-65063386 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 65061457 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021332] [ENSMUST00000120580] [ENSMUST00000129956] [ENSMUST00000220730] [ENSMUST00000221166] [ENSMUST00000221913]
Predicted Effect probably benign
Transcript: ENSMUST00000021332
SMART Domains Protein: ENSMUSP00000021332
Gene: ENSMUSG00000020949

DomainStartEndE-ValueType
PDB:2KFV|A 1 73 2e-45 PDB
low complexity region 91 100 N/A INTRINSIC
Pfam:FKBP_C 121 221 3.9e-33 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000120580
AA Change: Y659H
SMART Domains Protein: ENSMUSP00000112953
Gene: ENSMUSG00000035597
AA Change: Y659H

DomainStartEndE-ValueType
HAT 107 139 3.71e-2 SMART
HAT 141 173 4.39e-4 SMART
HAT 181 216 2.07e0 SMART
HAT 218 251 1.36e2 SMART
low complexity region 277 290 N/A INTRINSIC
Blast:HAT 323 363 6e-18 BLAST
HAT 365 397 3.2e-6 SMART
HAT 398 431 3.21e1 SMART
HAT 505 537 3.63e1 SMART
low complexity region 645 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129956
SMART Domains Protein: ENSMUSP00000114713
Gene: ENSMUSG00000035597

DomainStartEndE-ValueType
Blast:HAT 107 139 7e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220462
Predicted Effect probably benign
Transcript: ENSMUST00000220730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220957
Predicted Effect probably benign
Transcript: ENSMUST00000220983
Predicted Effect probably benign
Transcript: ENSMUST00000221166
Predicted Effect probably benign
Transcript: ENSMUST00000221608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221710
Predicted Effect probably benign
Transcript: ENSMUST00000221913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223167
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,582,943 G268R probably damaging Het
Amacr T A 15: 10,988,929 Y240* probably null Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Arhgef25 C A 10: 127,187,220 C106F probably damaging Het
Bean1 A T 8: 104,211,098 Q103L possibly damaging Het
Ccr9 A T 9: 123,779,376 N41I probably benign Het
Ceacam16 A G 7: 19,858,633 F117L probably benign Het
Col4a1 T C 8: 11,239,155 probably benign Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Csmd1 T A 8: 15,906,056 K3384* probably null Het
Ctnnd2 T A 15: 30,669,443 H399Q probably benign Het
Cutal T C 2: 34,882,313 Y30H possibly damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Defb30 C A 14: 63,035,972 C64F probably damaging Het
Eif2a T C 3: 58,539,539 I45T probably benign Het
Esyt1 T A 10: 128,511,524 D1044V probably damaging Het
Fam196b G A 11: 34,402,678 C240Y probably benign Het
Gabpb2 A T 3: 95,188,770 V382E probably damaging Het
Glb1 T A 9: 114,417,064 I61K probably damaging Het
Kcnt1 T C 2: 25,893,214 V263A possibly damaging Het
Kdm5b A G 1: 134,619,670 D1019G probably benign Het
Klhl2 A T 8: 64,743,075 L545M probably damaging Het
Klhl2 C A 8: 64,743,081 G543C probably damaging Het
Krt31 G T 11: 100,048,204 Q264K probably damaging Het
Lmnb1 A G 18: 56,731,019 D232G probably damaging Het
Loxhd1 T C 18: 77,414,159 F859L probably damaging Het
Map7 C A 10: 20,267,353 T416K unknown Het
Med18 T A 4: 132,462,940 I45F probably benign Het
Mn1 A T 5: 111,421,770 H1202L possibly damaging Het
Mpp7 T C 18: 7,444,062 D120G probably benign Het
Nlrp1b A T 11: 71,181,611 F469I possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Nrap G A 19: 56,381,552 A206V probably benign Het
Nuggc T C 14: 65,619,093 probably null Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr1335 T A 4: 118,809,303 Y187F probably benign Het
Olfr559 T C 7: 102,723,752 N246S probably damaging Het
Parp3 T C 9: 106,474,068 D278G probably damaging Het
Phc3 T A 3: 30,936,931 Q346L probably damaging Het
Pigo A G 4: 43,019,231 L1029P probably damaging Het
Plcb3 A G 19: 6,966,435 I66T probably damaging Het
Plch2 T C 4: 154,984,798 S1019G probably benign Het
Plekhg6 C A 6: 125,373,183 C264F probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pou4f2 G T 8: 78,435,438 H179N possibly damaging Het
Rapgef1 G A 2: 29,719,650 V700I probably benign Het
Rdh14 A G 12: 10,394,703 I185V probably benign Het
Rnf111 A T 9: 70,442,325 H785Q probably damaging Het
Rttn C T 18: 89,017,275 R758W probably benign Het
Sik3 G A 9: 46,202,063 V601M probably damaging Het
Slc22a14 T C 9: 119,178,486 T286A probably benign Het
Slc36a3 G A 11: 55,135,383 T203I probably benign Het
Spata31 A T 13: 64,922,654 Q872L probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Sphkap A T 1: 83,267,494 probably null Het
Stat6 T C 10: 127,655,379 V463A probably damaging Het
Stx7 T C 10: 24,185,049 S225P probably damaging Het
Sult2a7 A T 7: 14,473,409 probably benign Het
Tada2a A T 11: 84,103,120 F179L probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tfap2d A G 1: 19,165,963 I382V possibly damaging Het
Tshr C A 12: 91,537,743 A485D probably damaging Het
Vmn1r32 T A 6: 66,553,714 Y26F probably damaging Het
Vmn1r5 A G 6: 56,985,651 T104A probably damaging Het
Wbp1l T A 19: 46,653,957 probably null Het
Other mutations in Prpf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Prpf39 APN 12 65043263 missense probably damaging 0.99
IGL01025:Prpf39 APN 12 65042481 unclassified probably benign
IGL01323:Prpf39 APN 12 65042724 missense possibly damaging 0.70
IGL02346:Prpf39 APN 12 65057736 missense probably benign 0.02
IGL02966:Prpf39 APN 12 65042779 missense probably benign 0.45
IGL03189:Prpf39 APN 12 65043302 nonsense probably null
IGL03357:Prpf39 APN 12 65061437 unclassified probably benign
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0328:Prpf39 UTSW 12 65043371 splice site probably benign
R0549:Prpf39 UTSW 12 65056256 missense probably benign 0.05
R0840:Prpf39 UTSW 12 65048206 missense probably benign 0.21
R1248:Prpf39 UTSW 12 65053966 splice site probably benign
R1322:Prpf39 UTSW 12 65042662 missense possibly damaging 0.48
R1481:Prpf39 UTSW 12 65053314 missense probably damaging 1.00
R2209:Prpf39 UTSW 12 65057915 critical splice donor site probably null
R2232:Prpf39 UTSW 12 65044012 nonsense probably null
R2507:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2508:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2959:Prpf39 UTSW 12 65042523 missense probably damaging 1.00
R3117:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3118:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R4407:Prpf39 UTSW 12 65056266 missense probably damaging 1.00
R4620:Prpf39 UTSW 12 65042563 missense probably benign
R4926:Prpf39 UTSW 12 65044056 missense possibly damaging 0.90
R5154:Prpf39 UTSW 12 65048277 missense probably benign 0.29
R6248:Prpf39 UTSW 12 65042754 missense probably damaging 1.00
R6334:Prpf39 UTSW 12 65042813 splice site probably null
R6614:Prpf39 UTSW 12 65042563 missense probably benign
R6749:Prpf39 UTSW 12 65056274 missense possibly damaging 0.94
R6944:Prpf39 UTSW 12 65042680 missense probably benign 0.03
R7023:Prpf39 UTSW 12 65053300 missense possibly damaging 0.94
R7503:Prpf39 UTSW 12 65053393 missense probably benign 0.04
R7532:Prpf39 UTSW 12 65053371 missense probably benign 0.00
R7608:Prpf39 UTSW 12 65053446 missense probably benign 0.41
R8286:Prpf39 UTSW 12 65056358 missense probably benign
R8439:Prpf39 UTSW 12 65055262 missense possibly damaging 0.95
R8787:Prpf39 UTSW 12 65042781 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTTACTCTGTGCACTGGGG -3'
(R):5'- TGAGCTGCAAAAGAATTCTAGACC -3'

Sequencing Primer
(F):5'- TGCACTGGGGGCTCTATAC -3'
(R):5'- TGGTAGGAAAGTTTCTATGATA -3'
Posted On2015-04-29