Incidental Mutation 'R3980:Rttn'
ID 311295
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Name rotatin
Synonyms C530033I08Rik, 4921538A15Rik
MMRRC Submission 040843-MU
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288
Essential gene? Essential (E-score: 1.000) question?
Stock # R3980 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 88971790-89131013 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89017275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 758 (R758W)
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828]
AlphaFold Q8R4Y8
Predicted Effect probably benign
Transcript: ENSMUST00000023828
AA Change: R758W

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066
AA Change: R758W

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,582,943 G268R probably damaging Het
Amacr T A 15: 10,988,929 Y240* probably null Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Arhgef25 C A 10: 127,187,220 C106F probably damaging Het
Bean1 A T 8: 104,211,098 Q103L possibly damaging Het
Ccr9 A T 9: 123,779,376 N41I probably benign Het
Ceacam16 A G 7: 19,858,633 F117L probably benign Het
Col4a1 T C 8: 11,239,155 probably benign Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Csmd1 T A 8: 15,906,056 K3384* probably null Het
Ctnnd2 T A 15: 30,669,443 H399Q probably benign Het
Cutal T C 2: 34,882,313 Y30H possibly damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Defb30 C A 14: 63,035,972 C64F probably damaging Het
Eif2a T C 3: 58,539,539 I45T probably benign Het
Esyt1 T A 10: 128,511,524 D1044V probably damaging Het
Fam196b G A 11: 34,402,678 C240Y probably benign Het
Gabpb2 A T 3: 95,188,770 V382E probably damaging Het
Glb1 T A 9: 114,417,064 I61K probably damaging Het
Kcnt1 T C 2: 25,893,214 V263A possibly damaging Het
Kdm5b A G 1: 134,619,670 D1019G probably benign Het
Klhl2 A T 8: 64,743,075 L545M probably damaging Het
Klhl2 C A 8: 64,743,081 G543C probably damaging Het
Krt31 G T 11: 100,048,204 Q264K probably damaging Het
Lmnb1 A G 18: 56,731,019 D232G probably damaging Het
Loxhd1 T C 18: 77,414,159 F859L probably damaging Het
Map7 C A 10: 20,267,353 T416K unknown Het
Med18 T A 4: 132,462,940 I45F probably benign Het
Mn1 A T 5: 111,421,770 H1202L possibly damaging Het
Mpp7 T C 18: 7,444,062 D120G probably benign Het
Nlrp1b A T 11: 71,181,611 F469I possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Nrap G A 19: 56,381,552 A206V probably benign Het
Nuggc T C 14: 65,619,093 probably null Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr1335 T A 4: 118,809,303 Y187F probably benign Het
Olfr559 T C 7: 102,723,752 N246S probably damaging Het
Parp3 T C 9: 106,474,068 D278G probably damaging Het
Phc3 T A 3: 30,936,931 Q346L probably damaging Het
Pigo A G 4: 43,019,231 L1029P probably damaging Het
Plcb3 A G 19: 6,966,435 I66T probably damaging Het
Plch2 T C 4: 154,984,798 S1019G probably benign Het
Plekhg6 C A 6: 125,373,183 C264F probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pou4f2 G T 8: 78,435,438 H179N possibly damaging Het
Prpf39 T C 12: 65,061,457 probably benign Het
Rapgef1 G A 2: 29,719,650 V700I probably benign Het
Rdh14 A G 12: 10,394,703 I185V probably benign Het
Rnf111 A T 9: 70,442,325 H785Q probably damaging Het
Sik3 G A 9: 46,202,063 V601M probably damaging Het
Slc22a14 T C 9: 119,178,486 T286A probably benign Het
Slc36a3 G A 11: 55,135,383 T203I probably benign Het
Spata31 A T 13: 64,922,654 Q872L probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Sphkap A T 1: 83,267,494 probably null Het
Stat6 T C 10: 127,655,379 V463A probably damaging Het
Stx7 T C 10: 24,185,049 S225P probably damaging Het
Sult2a7 A T 7: 14,473,409 probably benign Het
Tada2a A T 11: 84,103,120 F179L probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tfap2d A G 1: 19,165,963 I382V possibly damaging Het
Tshr C A 12: 91,537,743 A485D probably damaging Het
Vmn1r32 T A 6: 66,553,714 Y26F probably damaging Het
Vmn1r5 A G 6: 56,985,651 T104A probably damaging Het
Wbp1l T A 19: 46,653,957 probably null Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
Fascisti UTSW 18 89009460 splice site probably benign
marcher UTSW 18 89037946 missense probably damaging 0.99
militaristi UTSW 18 89010916 missense probably damaging 1.00
Thoughtless UTSW 18 89014611 missense probably damaging 1.00
twister UTSW 18 89046162 critical splice donor site probably null
Vermiculus UTSW 18 89090433 missense probably benign
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0330:Rttn UTSW 18 88986080 splice site probably null
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R2266:Rttn UTSW 18 89064171 missense probably benign 0.05
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4223:Rttn UTSW 18 89095584 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4674:Rttn UTSW 18 89011011 splice site probably null
R4837:Rttn UTSW 18 89090415 splice site probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4959:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 splice site probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R6994:Rttn UTSW 18 89028899 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
R7565:Rttn UTSW 18 89060479 missense probably damaging 1.00
R7588:Rttn UTSW 18 89064229 missense probably damaging 0.97
R8029:Rttn UTSW 18 89090474 missense not run
R8085:Rttn UTSW 18 89053548 nonsense probably null
R8113:Rttn UTSW 18 89010916 missense probably damaging 1.00
R8355:Rttn UTSW 18 89028892 missense probably benign 0.05
R8531:Rttn UTSW 18 89113343 missense probably benign 0.00
R8992:Rttn UTSW 18 88977708 missense probably benign 0.24
R9008:Rttn UTSW 18 89009432 missense probably damaging 1.00
R9139:Rttn UTSW 18 89020137 missense probably benign 0.30
R9210:Rttn UTSW 18 89046162 critical splice donor site probably null
R9212:Rttn UTSW 18 89046162 critical splice donor site probably null
R9286:Rttn UTSW 18 88977725 missense probably benign 0.06
R9368:Rttn UTSW 18 89060452 missense probably damaging 1.00
R9632:Rttn UTSW 18 89017210 missense possibly damaging 0.82
R9710:Rttn UTSW 18 89017210 missense possibly damaging 0.82
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGGCTCTGTTATTCAATTGACTTG -3'
(R):5'- TGGATTGGTTCTCCAGCAAAATG -3'

Sequencing Primer
(F):5'- GGAATTAATGAATTGGCATGACATGC -3'
(R):5'- CTCCTAGGATGCTTCCAT -3'
Posted On 2015-04-29