Incidental Mutation 'R3980:Wbp1l'
ID311297
Institutional Source Beutler Lab
Gene Symbol Wbp1l
Ensembl Gene ENSMUSG00000047731
Gene NameWW domain binding protein 1 like
Synonyms
MMRRC Submission 040843-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3980 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location46599084-46657389 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 46653957 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099376] [ENSMUST00000099376] [ENSMUST00000111855] [ENSMUST00000111855] [ENSMUST00000111855] [ENSMUST00000111855] [ENSMUST00000132202] [ENSMUST00000132202] [ENSMUST00000138302] [ENSMUST00000138302]
Predicted Effect probably null
Transcript: ENSMUST00000099376
SMART Domains Protein: ENSMUSP00000096975
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:WBP-1 59 160 1.2e-52 PFAM
low complexity region 163 214 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099376
SMART Domains Protein: ENSMUSP00000096975
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:WBP-1 59 160 1.2e-52 PFAM
low complexity region 163 214 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111855
SMART Domains Protein: ENSMUSP00000107486
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
Pfam:WBP-1 22 123 1.1e-52 PFAM
low complexity region 126 177 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111855
SMART Domains Protein: ENSMUSP00000107486
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
Pfam:WBP-1 22 123 1.1e-52 PFAM
low complexity region 126 177 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111855
SMART Domains Protein: ENSMUSP00000107486
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
Pfam:WBP-1 22 123 1.1e-52 PFAM
low complexity region 126 177 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111855
SMART Domains Protein: ENSMUSP00000107486
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
Pfam:WBP-1 22 123 1.1e-52 PFAM
low complexity region 126 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132202
SMART Domains Protein: ENSMUSP00000121821
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:WBP-1 43 72 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132202
SMART Domains Protein: ENSMUSP00000121821
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:WBP-1 43 72 1.7e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138302
SMART Domains Protein: ENSMUSP00000117929
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:WBP-1 43 144 1.2e-52 PFAM
low complexity region 147 198 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138302
SMART Domains Protein: ENSMUSP00000117929
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:WBP-1 43 144 1.2e-52 PFAM
low complexity region 147 198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156649
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,582,943 G268R probably damaging Het
Amacr T A 15: 10,988,929 Y240* probably null Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Arhgef25 C A 10: 127,187,220 C106F probably damaging Het
Bean1 A T 8: 104,211,098 Q103L possibly damaging Het
Ccr9 A T 9: 123,779,376 N41I probably benign Het
Ceacam16 A G 7: 19,858,633 F117L probably benign Het
Col4a1 T C 8: 11,239,155 probably benign Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Csmd1 T A 8: 15,906,056 K3384* probably null Het
Ctnnd2 T A 15: 30,669,443 H399Q probably benign Het
Cutal T C 2: 34,882,313 Y30H possibly damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Defb30 C A 14: 63,035,972 C64F probably damaging Het
Eif2a T C 3: 58,539,539 I45T probably benign Het
Esyt1 T A 10: 128,511,524 D1044V probably damaging Het
Fam196b G A 11: 34,402,678 C240Y probably benign Het
Gabpb2 A T 3: 95,188,770 V382E probably damaging Het
Glb1 T A 9: 114,417,064 I61K probably damaging Het
Kcnt1 T C 2: 25,893,214 V263A possibly damaging Het
Kdm5b A G 1: 134,619,670 D1019G probably benign Het
Klhl2 A T 8: 64,743,075 L545M probably damaging Het
Klhl2 C A 8: 64,743,081 G543C probably damaging Het
Krt31 G T 11: 100,048,204 Q264K probably damaging Het
Lmnb1 A G 18: 56,731,019 D232G probably damaging Het
Loxhd1 T C 18: 77,414,159 F859L probably damaging Het
Map7 C A 10: 20,267,353 T416K unknown Het
Med18 T A 4: 132,462,940 I45F probably benign Het
Mn1 A T 5: 111,421,770 H1202L possibly damaging Het
Mpp7 T C 18: 7,444,062 D120G probably benign Het
Nlrp1b A T 11: 71,181,611 F469I possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Nrap G A 19: 56,381,552 A206V probably benign Het
Nuggc T C 14: 65,619,093 probably null Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr1335 T A 4: 118,809,303 Y187F probably benign Het
Olfr559 T C 7: 102,723,752 N246S probably damaging Het
Parp3 T C 9: 106,474,068 D278G probably damaging Het
Phc3 T A 3: 30,936,931 Q346L probably damaging Het
Pigo A G 4: 43,019,231 L1029P probably damaging Het
Plcb3 A G 19: 6,966,435 I66T probably damaging Het
Plch2 T C 4: 154,984,798 S1019G probably benign Het
Plekhg6 C A 6: 125,373,183 C264F probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pou4f2 G T 8: 78,435,438 H179N possibly damaging Het
Prpf39 T C 12: 65,061,457 probably benign Het
Rapgef1 G A 2: 29,719,650 V700I probably benign Het
Rdh14 A G 12: 10,394,703 I185V probably benign Het
Rnf111 A T 9: 70,442,325 H785Q probably damaging Het
Rttn C T 18: 89,017,275 R758W probably benign Het
Sik3 G A 9: 46,202,063 V601M probably damaging Het
Slc22a14 T C 9: 119,178,486 T286A probably benign Het
Slc36a3 G A 11: 55,135,383 T203I probably benign Het
Spata31 A T 13: 64,922,654 Q872L probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Sphkap A T 1: 83,267,494 probably null Het
Stat6 T C 10: 127,655,379 V463A probably damaging Het
Stx7 T C 10: 24,185,049 S225P probably damaging Het
Sult2a7 A T 7: 14,473,409 probably benign Het
Tada2a A T 11: 84,103,120 F179L probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tfap2d A G 1: 19,165,963 I382V possibly damaging Het
Tshr C A 12: 91,537,743 A485D probably damaging Het
Vmn1r32 T A 6: 66,553,714 Y26F probably damaging Het
Vmn1r5 A G 6: 56,985,651 T104A probably damaging Het
Other mutations in Wbp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Wbp1l APN 19 46644369 missense probably damaging 1.00
IGL01602:Wbp1l APN 19 46654400 missense possibly damaging 0.92
IGL01605:Wbp1l APN 19 46654400 missense possibly damaging 0.92
IGL01820:Wbp1l APN 19 46652483 missense probably damaging 1.00
IGL02058:Wbp1l APN 19 46652520 nonsense probably null
IGL02117:Wbp1l APN 19 46644437 missense probably benign 0.26
IGL02245:Wbp1l APN 19 46654618 missense possibly damaging 0.52
IGL02321:Wbp1l APN 19 46654310 missense probably benign 0.01
IGL03126:Wbp1l APN 19 46644399 missense probably damaging 0.96
PIT4810001:Wbp1l UTSW 19 46654322 missense probably benign 0.07
R0610:Wbp1l UTSW 19 46654670 missense probably damaging 1.00
R1636:Wbp1l UTSW 19 46644444 missense probably damaging 1.00
R3978:Wbp1l UTSW 19 46653957 splice site probably null
R5387:Wbp1l UTSW 19 46644457 critical splice donor site probably null
R5524:Wbp1l UTSW 19 46654256 missense possibly damaging 0.94
R5889:Wbp1l UTSW 19 46654180 nonsense probably null
R5935:Wbp1l UTSW 19 46654180 nonsense probably null
R5942:Wbp1l UTSW 19 46654430 missense probably damaging 1.00
R5964:Wbp1l UTSW 19 46654180 nonsense probably null
R5966:Wbp1l UTSW 19 46654180 nonsense probably null
R6480:Wbp1l UTSW 19 46654319 missense probably damaging 0.96
R7290:Wbp1l UTSW 19 46623437 intron probably benign
R7297:Wbp1l UTSW 19 46654400 missense possibly damaging 0.92
R7363:Wbp1l UTSW 19 46654130 missense possibly damaging 0.52
R8493:Wbp1l UTSW 19 46652549 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCAGTGAACCTTGGTGTCAC -3'
(R):5'- GACACTTGGAGGTCTTGTGC -3'

Sequencing Primer
(F):5'- CTTGACTGGTGATCAAAGCTCAC -3'
(R):5'- ACAAAGGACTGCTCTGCG -3'
Posted On2015-04-29