Mutagenetix > Incidental Mutations

Incidental Mutation 'R4002:Zbbx'

311304

Institutional Source

Beutler Lab

Gene Symbol

Zbbx

Ensembl Gene

ENSMUSG00000034151

Gene Name

zinc finger, B-box domain containing

Synonyms

MMRRC Submission

041609-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R4002 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75037907-75165034 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 75105671 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 151 (G151E)

Ref Sequence

ENSEMBL: ENSMUSP00000103405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107775] [ENSMUST00000107776] [ENSMUST00000107778]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039269
AA Change: G151E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: G151E

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	5e-22	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000107775
AA Change: G151E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103404
Gene: ENSMUSG00000034151
AA Change: G151E

Domain	Start	End	E-Value	Type
Pfam:zf-B_box	12	58	3.9e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107776
AA Change: G151E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103405
Gene: ENSMUSG00000034151
AA Change: G151E

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	1e-21	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107778
AA Change: G151E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: G151E

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	5e-22	BLAST

Meta Mutation Damage Score

0.1153

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

97% (29/30)

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	A	7: 41,625,540	N222K	possibly damaging	Het
Abca13	A	T	11: 9,585,415	M4680L	probably benign	Het
Adgrv1	GA	GAA	13: 81,540,132		probably null	Het
Afdn	T	C	17: 13,883,917	S1157P	probably damaging	Het
Ank1	A	G	8: 23,139,463	T63A	probably damaging	Het
Asah1	A	G	8: 41,348,139		probably benign	Het
Cdh18	T	A	15: 23,382,962	L277I	possibly damaging	Het
Ces3a	A	T	8: 105,057,461	D431V	probably damaging	Het
Dbx1	T	C	7: 49,636,517	S67G	probably benign	Het
Dmxl2	A	G	9: 54,473,832		probably benign	Het
Dnah7a	T	A	1: 53,631,681	T471S	probably benign	Het
Efcab8	A	T	2: 153,781,806	K70N	probably benign	Het
Gm5434	G	A	12: 36,090,636		probably benign	Het
Grcc10	A	T	6: 124,740,970	M1K	probably null	Het
Higd2a	G	C	13: 54,590,727	C53S	probably damaging	Het
Kcna4	C	T	2: 107,295,914	P331L	probably damaging	Het
Keg1	T	A	19: 12,718,943	S164T	possibly damaging	Het
Ltbp1	T	C	17: 75,310,159	V1031A	probably benign	Het
Obsl1	G	A	1: 75,500,099	T737I	possibly damaging	Het
Olfr129	G	A	17: 38,054,988	L193F	probably damaging	Het
Olfr853	C	T	9: 19,537,906	R8K	probably benign	Het
Olfr855	T	G	9: 19,584,714	M59R	probably damaging	Het
Serpinb6d	A	G	13: 33,670,647	M202V	probably damaging	Het
Tcf19	A	G	17: 35,515,925		probably null	Het
Tlr11	T	C	14: 50,362,527	F657L	probably benign	Het
Ttf2	G	A	3: 100,948,225	Q96*	probably null	Het
Zfp810	C	T	9: 22,278,892	C240Y	probably damaging	Het

Other mutations in Zbbx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Zbbx	APN	3	75061532	critical splice donor site	probably null
IGL01328:Zbbx	APN	3	75093075	nonsense	probably null
IGL01340:Zbbx	APN	3	75105650	missense	possibly damaging	0.53
IGL01631:Zbbx	APN	3	75078677	missense	probably damaging	0.99
IGL01681:Zbbx	APN	3	75052478	missense	probably damaging	1.00
IGL02427:Zbbx	APN	3	75139598	missense	probably benign	0.04
IGL03077:Zbbx	APN	3	75081846	missense	possibly damaging	0.61
IGL03115:Zbbx	APN	3	75078560	missense	probably benign	0.03
IGL03162:Zbbx	APN	3	75071623	splice site	probably benign
Eland	UTSW	3	75071712	missense	probably benign	0.01
PIT4480001:Zbbx	UTSW	3	75136487	missense	probably damaging	1.00
PIT4495001:Zbbx	UTSW	3	75061637	missense	probably damaging	1.00
R0179:Zbbx	UTSW	3	75085562	splice site	probably benign
R0396:Zbbx	UTSW	3	75078495	missense	possibly damaging	0.81
R0523:Zbbx	UTSW	3	75081858	missense	probably benign	0.03
R0603:Zbbx	UTSW	3	75078450	missense	probably benign	0.05
R0745:Zbbx	UTSW	3	75155427	missense	probably damaging	1.00
R0747:Zbbx	UTSW	3	75155427	missense	probably damaging	1.00
R1208:Zbbx	UTSW	3	75037992	missense	possibly damaging	0.94
R1208:Zbbx	UTSW	3	75037992	missense	possibly damaging	0.94
R1371:Zbbx	UTSW	3	75052477	missense	possibly damaging	0.58
R1769:Zbbx	UTSW	3	75083619	splice site	probably benign
R1906:Zbbx	UTSW	3	75071740	missense	probably damaging	1.00
R2069:Zbbx	UTSW	3	75078412	missense	probably benign	0.01
R2165:Zbbx	UTSW	3	75112107	missense	probably damaging	0.99
R2174:Zbbx	UTSW	3	75052414	missense	possibly damaging	0.93
R2979:Zbbx	UTSW	3	75078486	nonsense	probably null
R3121:Zbbx	UTSW	3	75081846	missense	possibly damaging	0.88
R3755:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R3756:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R3816:Zbbx	UTSW	3	75085495	missense	probably benign	0.00
R4003:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4057:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4072:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4073:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4075:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4114:Zbbx	UTSW	3	75139598	missense	probably benign	0.04
R4784:Zbbx	UTSW	3	75085041	missense	probably benign	0.05
R4821:Zbbx	UTSW	3	75081747	missense	possibly damaging	0.68
R5008:Zbbx	UTSW	3	75151448	missense	possibly damaging	0.62
R5030:Zbbx	UTSW	3	75083683	missense	possibly damaging	0.83
R5388:Zbbx	UTSW	3	75083670	missense	probably damaging	0.98
R6398:Zbbx	UTSW	3	75078565	missense	probably damaging	0.96
R6462:Zbbx	UTSW	3	75078659	missense	probably benign	0.07
R6597:Zbbx	UTSW	3	75136454	missense	probably damaging	1.00
R6882:Zbbx	UTSW	3	75071712	missense	probably benign	0.01
R7084:Zbbx	UTSW	3	75139546	missense	possibly damaging	0.92
R7096:Zbbx	UTSW	3	75081737	missense	probably benign	0.03
R7102:Zbbx	UTSW	3	75112094	missense	probably benign	0.06
R7256:Zbbx	UTSW	3	75039898	missense	probably benign	0.02
R7537:Zbbx	UTSW	3	75085519	missense	probably damaging	1.00
R7836:Zbbx	UTSW	3	75078474	missense	possibly damaging	0.65
R7905:Zbbx	UTSW	3	75085513	missense	probably benign	0.23
R8110:Zbbx	UTSW	3	75155442	missense	possibly damaging	0.58
R8367:Zbbx	UTSW	3	75081727	critical splice donor site	probably null
Z1177:Zbbx	UTSW	3	75071783	critical splice acceptor site	probably null
Z1177:Zbbx	UTSW	3	75105684	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTTGGGAAGCTCTAGCAAATTG -3'
(R):5'- TGAGCCAACCATTTATAACTGC -3'

Sequencing Primer
(F):5'- GCTCTTTATTGGTTTTAAGCATCAC -3'
(R):5'- TCATGTCCTGATAAGATGCAGG -3'

Posted On

2015-04-29