Incidental Mutation 'R4002:Ttf2'
ID311305
Institutional Source Beutler Lab
Gene Symbol Ttf2
Ensembl Gene ENSMUSG00000033222
Gene Nametranscription termination factor, RNA polymerase II
Synonyms
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4002 (G1)
Quality Score89
Status Validated
Chromosome3
Chromosomal Location100938860-100969663 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 100948225 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 96 (Q96*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076941]
Predicted Effect probably null
Transcript: ENSMUST00000076941
AA Change: Q885*
SMART Domains Protein: ENSMUSP00000076208
Gene: ENSMUSG00000033222
AA Change: Q885*

DomainStartEndE-ValueType
Pfam:zf-GRF 4 44 2.3e-10 PFAM
low complexity region 328 340 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 458 479 N/A INTRINSIC
DEXDc 542 774 8.6e-35 SMART
Blast:DEXDc 839 892 8e-7 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 917 932 N/A INTRINSIC
HELICc 999 1082 5.61e-16 SMART
low complexity region 1099 1110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145811
Predicted Effect probably null
Transcript: ENSMUST00000151697
AA Change: Q96*
SMART Domains Protein: ENSMUSP00000119032
Gene: ENSMUSG00000033222
AA Change: Q96*

DomainStartEndE-ValueType
Blast:DEXDc 21 82 1e-20 BLAST
low complexity region 105 121 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI2/SNF2 family of proteins, which play a critical role in altering protein-DNA interactions. The encoded protein has been shown to have dsDNA-dependent ATPase activity and RNA polymerase II termination activity. This protein interacts with cell division cycle 5-like, associates with human splicing complexes, and plays a role in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Ttf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Ttf2 APN 3 100967097 splice site probably benign
IGL01578:Ttf2 APN 3 100956195 missense possibly damaging 0.59
IGL02218:Ttf2 APN 3 100964093 missense possibly damaging 0.61
IGL03267:Ttf2 APN 3 100944804 nonsense probably null
FR4548:Ttf2 UTSW 3 100963160 small insertion probably benign
FR4737:Ttf2 UTSW 3 100963160 small insertion probably benign
R0784:Ttf2 UTSW 3 100962710 missense probably benign 0.01
R0894:Ttf2 UTSW 3 100969549 splice site probably benign
R2083:Ttf2 UTSW 3 100969501 missense probably benign 0.18
R2125:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2126:Ttf2 UTSW 3 100948193 missense possibly damaging 0.93
R2230:Ttf2 UTSW 3 100957944 missense probably damaging 0.99
R3084:Ttf2 UTSW 3 100948264 missense possibly damaging 0.56
R3700:Ttf2 UTSW 3 100951008 missense probably damaging 1.00
R3963:Ttf2 UTSW 3 100941820 unclassified probably benign
R4290:Ttf2 UTSW 3 100962761 missense probably benign 0.01
R4833:Ttf2 UTSW 3 100961406 missense probably benign 0.00
R4909:Ttf2 UTSW 3 100954315 missense probably damaging 1.00
R5011:Ttf2 UTSW 3 100963169 missense probably benign 0.14
R5523:Ttf2 UTSW 3 100959242 missense probably damaging 1.00
R5669:Ttf2 UTSW 3 100951117 nonsense probably null
R6531:Ttf2 UTSW 3 100956260 missense probably damaging 0.99
R6776:Ttf2 UTSW 3 100952553 missense probably benign 0.01
R6795:Ttf2 UTSW 3 100959262 missense probably damaging 1.00
R6861:Ttf2 UTSW 3 100969625 missense possibly damaging 0.89
R6940:Ttf2 UTSW 3 100969515 missense probably damaging 1.00
R6958:Ttf2 UTSW 3 100945932 missense probably benign 0.30
R6962:Ttf2 UTSW 3 100951137 missense probably damaging 1.00
R7211:Ttf2 UTSW 3 100959307 missense probably benign 0.00
R7365:Ttf2 UTSW 3 100963302 missense possibly damaging 0.92
R7470:Ttf2 UTSW 3 100963162 missense possibly damaging 0.85
R7534:Ttf2 UTSW 3 100950412 splice site probably null
R8023:Ttf2 UTSW 3 100956255 missense probably benign 0.01
R8087:Ttf2 UTSW 3 100964096 missense probably damaging 0.96
R8219:Ttf2 UTSW 3 100962563 missense possibly damaging 0.94
R8757:Ttf2 UTSW 3 100950332 missense probably damaging 1.00
R8872:Ttf2 UTSW 3 100963328 missense probably benign 0.04
R8888:Ttf2 UTSW 3 100962712 missense probably benign 0.00
R8895:Ttf2 UTSW 3 100962712 missense probably benign 0.00
R8900:Ttf2 UTSW 3 100952640 missense probably damaging 1.00
R8942:Ttf2 UTSW 3 100961726 missense probably benign 0.00
RF027:Ttf2 UTSW 3 100963157 small insertion probably benign
RF035:Ttf2 UTSW 3 100963157 small insertion probably benign
Z1177:Ttf2 UTSW 3 100959266 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTTTTCATACACCCCAGAGT -3'
(R):5'- CAAGGTTATTGAGTGTCAGGTCA -3'

Sequencing Primer
(F):5'- GCAGAAGAAATGCGTTTCCTC -3'
(R):5'- CAGGTCAAACTGTTTAAGTAGCTGG -3'
Posted On2015-04-29