Incidental Mutation 'R4002:Olfr855'
ID311312
Institutional Source Beutler Lab
Gene Symbol Olfr855
Ensembl Gene ENSMUSG00000043087
Gene Nameolfactory receptor 855
SynonymsMOR148-1, GA_x6K02T2PVTD-13330461-13331399
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4002 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19582617-19586030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 19584714 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 59 (M59R)
Ref Sequence ENSEMBL: ENSMUSP00000150218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061693] [ENSMUST00000215587]
Predicted Effect probably damaging
Transcript: ENSMUST00000061693
AA Change: M59R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054790
Gene: ENSMUSG00000043087
AA Change: M59R

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 182 5.2e-8 PFAM
Pfam:7tm_1 43 292 2.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215587
AA Change: M59R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4872 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Olfr855
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr855 APN 9 19585320 missense possibly damaging 0.74
IGL01405:Olfr855 APN 9 19585205 missense probably benign 0.23
IGL01775:Olfr855 APN 9 19584705 missense probably benign 0.04
IGL01920:Olfr855 APN 9 19585022 missense probably benign 0.01
R0501:Olfr855 UTSW 9 19584618 missense probably damaging 1.00
R0600:Olfr855 UTSW 9 19585304 missense possibly damaging 0.47
R0667:Olfr855 UTSW 9 19585447 missense probably benign
R1769:Olfr855 UTSW 9 19585386 missense probably damaging 0.98
R3117:Olfr855 UTSW 9 19584941 missense probably damaging 0.99
R4003:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4043:Olfr855 UTSW 9 19584995 missense probably benign 0.16
R4243:Olfr855 UTSW 9 19584558 missense probably damaging 1.00
R4672:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4673:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4959:Olfr855 UTSW 9 19585208 missense probably benign
R4973:Olfr855 UTSW 9 19585208 missense probably benign
R5223:Olfr855 UTSW 9 19585026 missense probably benign 0.16
R5681:Olfr855 UTSW 9 19584899 missense probably damaging 1.00
R6005:Olfr855 UTSW 9 19584885 missense probably benign 0.45
R6017:Olfr855 UTSW 9 19585434 missense probably benign 0.00
R6145:Olfr855 UTSW 9 19584888 missense probably benign 0.02
R6615:Olfr855 UTSW 9 19584989 missense probably benign 0.05
R6771:Olfr855 UTSW 9 19585379 missense probably benign 0.16
R6969:Olfr855 UTSW 9 19584590 missense possibly damaging 0.77
R7239:Olfr855 UTSW 9 19585191 missense probably damaging 1.00
R7313:Olfr855 UTSW 9 19584642 missense probably damaging 1.00
R7361:Olfr855 UTSW 9 19584560 missense probably benign 0.00
R8112:Olfr855 UTSW 9 19584724 missense probably benign 0.44
R8470:Olfr855 UTSW 9 19584969 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACAAGAAACATGGAGCCC -3'
(R):5'- CTTAATGGGTGACAAATAGCTGC -3'

Sequencing Primer
(F):5'- TGGAGCCCCAAAACAAAACG -3'
(R):5'- TGCATAGCGATCATAGGCC -3'
Posted On2015-04-29