Incidental Mutation 'R4002:Gm5434'
ID311317
Institutional Source Beutler Lab
Gene Symbol Gm5434
Ensembl Gene ENSMUSG00000059301
Gene Namepredicted gene 5434
Synonyms
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4002 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location36090379-36091829 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 36090636 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020856]
Predicted Effect probably benign
Transcript: ENSMUST00000020856
SMART Domains Protein: ENSMUSP00000020856
Gene: ENSMUSG00000020547

DomainStartEndE-ValueType
eIF5C 326 411 3.29e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000071825
SMART Domains Protein: ENSMUSP00000071728
Gene: ENSMUSG00000059301

DomainStartEndE-ValueType
UBCc 35 185 6.96e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222384
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Keg1 T A 19: 12,718,943 S164T possibly damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Gm5434
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0948:Gm5434 UTSW 12 36090935 unclassified probably benign
R1954:Gm5434 UTSW 12 36090596 unclassified probably benign
R1955:Gm5434 UTSW 12 36090596 unclassified probably benign
R2885:Gm5434 UTSW 12 36090575 unclassified probably benign
R2886:Gm5434 UTSW 12 36090575 unclassified probably benign
R3825:Gm5434 UTSW 12 36091037 unclassified probably benign
R4803:Gm5434 UTSW 12 36090730 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GATTCGTGGTGCTCAGAAAGG -3'
(R):5'- CAGCGGAATGTTCTCTTAGTAAAC -3'

Sequencing Primer
(F):5'- GTGGCAGTAATGCTAACGCTG -3'
(R):5'- GTAAACTTAGACATATTTCCCCCG -3'
Posted On2015-04-29