Incidental Mutation 'R4002:Keg1'
ID311328
Institutional Source Beutler Lab
Gene Symbol Keg1
Ensembl Gene ENSMUSG00000024694
Gene Namekidney expressed gene 1
Synonyms0610008P16Rik, GS4059
MMRRC Submission 041609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4002 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12695786-12719902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12718943 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 164 (S164T)
Ref Sequence ENSEMBL: ENSMUSP00000119879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025598] [ENSMUST00000138545] [ENSMUST00000154822]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025598
AA Change: S217T

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025598
Gene: ENSMUSG00000024694
AA Change: S217T

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 205 1.2e-89 PFAM
Pfam:Gly_acyl_tr_C 206 294 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128987
Predicted Effect possibly damaging
Transcript: ENSMUST00000138545
AA Change: S207T

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116555
Gene: ENSMUSG00000024694
AA Change: S207T

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 195 4.2e-96 PFAM
Pfam:Gly_acyl_tr_C 196 228 4.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152017
Predicted Effect possibly damaging
Transcript: ENSMUST00000154822
AA Change: S164T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119879
Gene: ENSMUSG00000024694
AA Change: S164T

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 156 1.2e-71 PFAM
Pfam:Gly_acyl_tr_C 153 221 3.2e-37 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (29/30)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,540 N222K possibly damaging Het
Abca13 A T 11: 9,585,415 M4680L probably benign Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Afdn T C 17: 13,883,917 S1157P probably damaging Het
Ank1 A G 8: 23,139,463 T63A probably damaging Het
Asah1 A G 8: 41,348,139 probably benign Het
Cdh18 T A 15: 23,382,962 L277I possibly damaging Het
Ces3a A T 8: 105,057,461 D431V probably damaging Het
Dbx1 T C 7: 49,636,517 S67G probably benign Het
Dmxl2 A G 9: 54,473,832 probably benign Het
Dnah7a T A 1: 53,631,681 T471S probably benign Het
Efcab8 A T 2: 153,781,806 K70N probably benign Het
Gm5434 G A 12: 36,090,636 probably benign Het
Grcc10 A T 6: 124,740,970 M1K probably null Het
Higd2a G C 13: 54,590,727 C53S probably damaging Het
Kcna4 C T 2: 107,295,914 P331L probably damaging Het
Ltbp1 T C 17: 75,310,159 V1031A probably benign Het
Obsl1 G A 1: 75,500,099 T737I possibly damaging Het
Olfr129 G A 17: 38,054,988 L193F probably damaging Het
Olfr853 C T 9: 19,537,906 R8K probably benign Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Serpinb6d A G 13: 33,670,647 M202V probably damaging Het
Tcf19 A G 17: 35,515,925 probably null Het
Tlr11 T C 14: 50,362,527 F657L probably benign Het
Ttf2 G A 3: 100,948,225 Q96* probably null Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp810 C T 9: 22,278,892 C240Y probably damaging Het
Other mutations in Keg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Keg1 APN 19 12719000 missense probably damaging 1.00
IGL01084:Keg1 APN 19 12714612 missense probably damaging 1.00
IGL02563:Keg1 APN 19 12719157 missense probably damaging 1.00
IGL03328:Keg1 APN 19 12719097 missense probably damaging 1.00
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0417:Keg1 UTSW 19 12711060 missense probably damaging 1.00
R1300:Keg1 UTSW 19 12719004 missense probably damaging 0.98
R1476:Keg1 UTSW 19 12716023 missense probably benign
R1482:Keg1 UTSW 19 12718821 missense probably damaging 1.00
R1643:Keg1 UTSW 19 12719042 missense probably benign 0.00
R5022:Keg1 UTSW 19 12719157 missense probably damaging 1.00
R5164:Keg1 UTSW 19 12714680 intron probably benign
R5386:Keg1 UTSW 19 12714538 missense probably damaging 1.00
R6289:Keg1 UTSW 19 12714573 missense probably damaging 0.98
R6517:Keg1 UTSW 19 12715910 missense probably benign 0.00
R6656:Keg1 UTSW 19 12709630 nonsense probably null
R7117:Keg1 UTSW 19 12709678 missense probably damaging 1.00
R7676:Keg1 UTSW 19 12716045 missense probably benign 0.00
R7807:Keg1 UTSW 19 12714634 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTCTCAATAGTGACCAGCAG -3'
(R):5'- GTTCCACTGGTTCCAGGTAC -3'

Sequencing Primer
(F):5'- GACCAGCAGTTATTCAAATTTGCCTC -3'
(R):5'- ACTGGTTCCAGGTACAAGGC -3'
Posted On2015-04-29