Incidental Mutation 'R4003:Hif3a'
ID311342
Institutional Source Beutler Lab
Gene Symbol Hif3a
Ensembl Gene ENSMUSG00000004328
Gene Namehypoxia inducible factor 3, alpha subunit
SynonymsMOP7, Nepas, bHLHe17
MMRRC Submission 040945-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R4003 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17031507-17062427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17044919 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 358 (Q358H)
Ref Sequence ENSEMBL: ENSMUSP00000104132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037762] [ENSMUST00000108492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037762
AA Change: Q356H

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048248
Gene: ENSMUSG00000004328
AA Change: Q356H

DomainStartEndE-ValueType
HLH 18 73 1.57e-7 SMART
PAS 82 148 9.83e-10 SMART
PAS 225 293 2.72e-3 SMART
PAC 299 342 2.18e-2 SMART
low complexity region 421 437 N/A INTRINSIC
Pfam:HIF-1 472 505 1.8e-18 PFAM
low complexity region 508 520 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108492
AA Change: Q358H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104132
Gene: ENSMUSG00000004328
AA Change: Q358H

DomainStartEndE-ValueType
HLH 20 75 1.57e-7 SMART
PAS 84 150 9.83e-10 SMART
PAS 227 295 2.72e-3 SMART
PAC 301 344 2.18e-2 SMART
low complexity region 423 439 N/A INTRINSIC
Pfam:HIF-1 475 506 5.7e-18 PFAM
low complexity region 510 522 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139224
Meta Mutation Damage Score 0.1379 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha-3 subunit of one of several alpha/beta-subunit heterodimeric transcription factors that regulate many adaptive responses to low oxygen tension (hypoxia). The alpha-3 subunit lacks the transactivation domain found in factors containing either the alpha-1 or alpha-2 subunits. It is thought that factors containing the alpha-3 subunit are negative regulators of hypoxia-inducible gene expression. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired lung remodeling resulting in hypertrophy of the heart right ventricle and pulmonary hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik T C X: 89,930,510 I694V probably benign Het
9330182L06Rik A C 5: 9,440,877 E629A probably benign Het
Adgrf4 A T 17: 42,669,759 I145N probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Bmp8b T A 4: 123,121,878 probably benign Het
Cdhr2 A T 13: 54,718,266 E293V probably benign Het
Cerkl C A 2: 79,428,794 R33L possibly damaging Het
Chd9 C T 8: 90,956,557 R542C probably damaging Het
Csnk2a1 A G 2: 152,250,575 E22G probably damaging Het
Dnah7c A G 1: 46,681,817 K2834E probably damaging Het
Eftud2 C T 11: 102,860,110 E286K possibly damaging Het
Fam222b C T 11: 78,154,929 P439S probably benign Het
Gm498 A T 7: 143,897,303 M350L probably benign Het
Gsn A G 2: 35,283,983 K35E probably benign Het
L3hypdh T C 12: 72,085,116 D14G probably benign Het
Map2 T C 1: 66,415,740 I1263T probably damaging Het
Mrgprx3-ps T C 7: 47,310,211 T11A probably benign Het
Mylk C A 16: 34,963,577 A1371D probably benign Het
Myo1b A G 1: 51,799,530 probably null Het
Olfr855 T G 9: 19,584,714 M59R probably damaging Het
Pkp3 A G 7: 141,088,737 probably null Het
Ptprt A G 2: 161,566,117 probably benign Het
Rabep1 T A 11: 70,917,367 M340K probably benign Het
Scn10a T C 9: 119,608,968 D1945G probably null Het
Slc22a2 A T 17: 12,612,450 I376F probably benign Het
Slc34a1 T C 13: 55,402,661 probably benign Het
Smc2 T C 4: 52,462,897 V629A probably damaging Het
Stab2 G T 10: 86,858,124 D633E probably damaging Het
Tmco3 G A 8: 13,291,959 V78M probably damaging Het
Tnfaip2 C T 12: 111,451,344 probably benign Het
Tnfrsf25 T C 4: 152,119,601 M333T probably damaging Het
Triobp A G 15: 78,959,977 probably benign Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp236 A T 18: 82,680,745 C70* probably null Het
Zfp384 T C 6: 125,033,237 probably benign Het
Zfp619 A G 7: 39,537,306 E920G possibly damaging Het
Zhx3 G A 2: 160,780,889 P453S probably damaging Het
Other mutations in Hif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Hif3a APN 7 17051916 splice site probably null
IGL02496:Hif3a APN 7 17039678 splice site probably benign
IGL02572:Hif3a APN 7 17050588 missense probably null
IGL02638:Hif3a APN 7 17044368 unclassified probably benign
IGL02704:Hif3a APN 7 17050761 unclassified probably benign
IGL03000:Hif3a APN 7 17048639 missense probably benign 0.08
IGL03342:Hif3a APN 7 17041122 missense possibly damaging 0.92
R0265:Hif3a UTSW 7 17035868 makesense probably null
R0326:Hif3a UTSW 7 17044400 missense probably benign 0.01
R0396:Hif3a UTSW 7 17052021 splice site probably benign
R1494:Hif3a UTSW 7 17054722 missense probably damaging 1.00
R1529:Hif3a UTSW 7 17042639 missense probably benign 0.02
R1548:Hif3a UTSW 7 17044403 missense probably benign 0.00
R1686:Hif3a UTSW 7 17044864 missense possibly damaging 0.46
R1916:Hif3a UTSW 7 17039656 missense possibly damaging 0.87
R2026:Hif3a UTSW 7 17044397 missense possibly damaging 0.81
R2032:Hif3a UTSW 7 17051179 missense probably damaging 1.00
R2354:Hif3a UTSW 7 17041105 missense probably damaging 1.00
R3693:Hif3a UTSW 7 17041074 missense probably damaging 1.00
R3780:Hif3a UTSW 7 17054713 missense probably damaging 1.00
R3921:Hif3a UTSW 7 17037172 missense possibly damaging 0.80
R4714:Hif3a UTSW 7 17056271 missense probably damaging 1.00
R4953:Hif3a UTSW 7 17050565 missense probably damaging 0.98
R5632:Hif3a UTSW 7 17050655 missense possibly damaging 0.94
R5778:Hif3a UTSW 7 17051984 missense probably damaging 1.00
R5877:Hif3a UTSW 7 17051146 missense probably damaging 1.00
R5995:Hif3a UTSW 7 17053769 missense probably benign 0.10
R6001:Hif3a UTSW 7 17050561 missense probably damaging 1.00
R6599:Hif3a UTSW 7 17042605 missense possibly damaging 0.68
R7218:Hif3a UTSW 7 17050588 missense probably damaging 1.00
R7478:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7479:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7480:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7482:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7654:Hif3a UTSW 7 17049096 missense probably damaging 0.97
R7696:Hif3a UTSW 7 17054787 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAATGGCCACTGTGTTCGC -3'
(R):5'- GTGGCAAATTCCCTTCAGC -3'

Sequencing Primer
(F):5'- TGGGTCATCTCACAGCCAGATTG -3'
(R):5'- AGCTCCTGGGTGAAATGGC -3'
Posted On2015-04-29