Incidental Mutation 'R0383:Lox'
ID31136
Institutional Source Beutler Lab
Gene Symbol Lox
Ensembl Gene ENSMUSG00000024529
Gene Namelysyl oxidase
SynonymsTSC-160, ras recision gene (rrg)
MMRRC Submission 038589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0383 (G1)
Quality Score172
Status Not validated
Chromosome18
Chromosomal Location52516069-52529867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52529199 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 44 (N44S)
Ref Sequence ENSEMBL: ENSMUSP00000129247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025409] [ENSMUST00000171470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025409
AA Change: N44S

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025409
Gene: ENSMUSG00000024529
AA Change: N44S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 411 2.3e-121 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171470
AA Change: N44S

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129247
Gene: ENSMUSG00000024529
AA Change: N44S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 408 3.7e-96 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a precursor protein that belongs to the lysyl oxidase family of proteins. The secreted proprotein is proteolytically processed to an active mature peptide and a propeptide. This propeptide is thought to function in tumor suppression by inhibiting the Ras signaling pathway. The active enzyme plays a role in cross-linking of collagen and elastin and is essential for development of cardiovascular and respiratory systems, and development of skin and connective tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to altered arterial wall structure, aortic aneurysms, cardiovascular dysfunction, diaphragmatic hernia, and perinatal death. Abnormal development of the respiratory system, and elastic and collagen fiber abnormalities in the lung and skin are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,239,539 M537V probably benign Het
5730455P16Rik G T 11: 80,363,941 Y351* probably null Het
A530099J19Rik A G 13: 19,729,147 noncoding transcript Het
Aadac G T 3: 60,035,947 R91L possibly damaging Het
Adgrg1 T A 8: 95,011,742 F621Y probably damaging Het
Ankmy1 G T 1: 92,885,053 D511E probably benign Het
Anks4b A T 7: 120,182,874 D376V probably damaging Het
Aox1 G T 1: 58,061,241 C399F probably benign Het
Arfgef1 C T 1: 10,198,842 probably null Het
Arhgef4 G A 1: 34,810,533 V546M probably damaging Het
Cab39 T A 1: 85,837,299 V98E probably damaging Het
Cacna1b T C 2: 24,761,844 N108D probably damaging Het
Car15 C A 16: 17,836,753 E134* probably null Het
Ccdc80 T G 16: 45,095,369 Y163D probably damaging Het
Col22a1 C T 15: 71,869,004 G513D unknown Het
Col8a1 T C 16: 57,632,442 D66G probably damaging Het
Crot C A 5: 8,968,734 S544I probably damaging Het
Cubn G T 2: 13,430,959 P1062Q probably damaging Het
Dcc A T 18: 71,420,263 V774E probably damaging Het
Dlgap5 T A 14: 47,410,361 M240L probably benign Het
Dlx4 A G 11: 95,145,435 V16A probably benign Het
Dnah17 G T 11: 118,067,547 H2703Q probably benign Het
Duox2 A G 2: 122,291,810 probably null Het
Fn1 C T 1: 71,597,685 V168I probably damaging Het
Fpr-rs4 A T 17: 18,022,097 D122V probably damaging Het
Gas2l2 A T 11: 83,423,097 I463N probably benign Het
Ggta1 G T 2: 35,402,404 P297Q probably damaging Het
Gpatch3 C A 4: 133,578,146 R231S probably damaging Het
Gpc1 T C 1: 92,854,983 Y151H probably damaging Het
Gtf2e2 T C 8: 33,755,945 W119R probably damaging Het
H2-M10.2 T C 17: 36,284,361 I304V probably benign Het
Helq T C 5: 100,779,165 K685R probably benign Het
Hps5 C T 7: 46,769,288 probably null Het
Iars T C 13: 49,732,342 C1186R probably damaging Het
Ift43 T C 12: 86,162,021 V158A possibly damaging Het
Iqca A T 1: 90,142,707 I141N probably damaging Het
Kat6b A G 14: 21,669,081 N1276S probably benign Het
Kif19a A T 11: 114,765,514 M1L possibly damaging Het
Kif1b T G 4: 149,202,512 H1241P probably damaging Het
Kif26a T C 12: 112,178,076 V1588A possibly damaging Het
Klb T A 5: 65,372,499 probably null Het
Krtap26-1 A T 16: 88,647,243 Y163* probably null Het
Lefty1 G T 1: 180,937,634 E256* probably null Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mctp1 A G 13: 76,801,544 Y565C probably damaging Het
Megf6 C T 4: 154,265,326 A961V probably benign Het
Mindy4 A G 6: 55,276,634 K496R probably benign Het
Nalcn A T 14: 123,507,559 H352Q probably benign Het
Ncoa5 T C 2: 165,009,390 I188V possibly damaging Het
Notum G T 11: 120,654,456 H426N probably benign Het
Olfr569 T A 7: 102,887,251 I301F possibly damaging Het
Orm2 A T 4: 63,363,996 D137V probably damaging Het
Pabpc2 G A 18: 39,775,395 G571D probably damaging Het
Pabpc4 A G 4: 123,297,942 N599S probably damaging Het
Pak1ip1 T C 13: 41,012,604 V335A probably benign Het
Pcdhb11 A C 18: 37,423,393 D592A probably damaging Het
Pmch C A 10: 88,091,258 T41K possibly damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Pter G T 2: 13,000,942 G309* probably null Het
Ptprg T C 14: 12,219,024 V406A possibly damaging Het
Ranbp3l A T 15: 9,063,104 E467V possibly damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Ripk4 C T 16: 97,748,112 C248Y probably damaging Het
Slc6a15 T C 10: 103,418,053 W617R probably damaging Het
Smyd5 C T 6: 85,440,173 Q178* probably null Het
St18 T A 1: 6,803,024 F328I probably damaging Het
Supt20 T A 3: 54,703,149 L124* probably null Het
Tarbp1 T A 8: 126,447,484 H861L probably benign Het
Tars A G 15: 11,390,325 M356T probably benign Het
Tbc1d10a A G 11: 4,212,819 T221A probably damaging Het
Tead3 A G 17: 28,334,698 probably null Het
Tprg A G 16: 25,422,235 T254A probably damaging Het
Trank1 C A 9: 111,391,477 N2427K probably benign Het
Ttc30b A G 2: 75,938,242 Y56H probably damaging Het
Tufm T C 7: 126,489,864 S380P probably damaging Het
Tyrobp C T 7: 30,414,617 R68C probably damaging Het
Ubl4b T C 3: 107,554,827 E39G possibly damaging Het
Uggt2 A T 14: 119,049,451 F661I probably damaging Het
Upf3b A G X: 37,104,467 I144T probably benign Het
Usp54 A T 14: 20,561,252 D1165E probably benign Het
Vmn2r81 C T 10: 79,293,447 T724I possibly damaging Het
Vsig1 A G X: 140,936,313 I247M possibly damaging Het
Zfp110 C A 7: 12,849,260 L612I probably benign Het
Zfp318 C A 17: 46,413,296 T2075K probably damaging Het
Zfp37 A G 4: 62,191,885 M1T probably null Het
Zfp605 T A 5: 110,128,854 C613S probably damaging Het
Zfp729a G A 13: 67,621,673 P146S possibly damaging Het
Zfp85 T C 13: 67,748,672 N427S probably benign Het
Other mutations in Lox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lox APN 18 52520854 missense possibly damaging 0.74
IGL02457:Lox APN 18 52521316 missense probably damaging 1.00
IGL02665:Lox APN 18 52525244 splice site probably benign
R0040:Lox UTSW 18 52520826 missense possibly damaging 0.91
R0658:Lox UTSW 18 52528883 missense probably benign 0.00
R1391:Lox UTSW 18 52528819 missense probably damaging 0.99
R1721:Lox UTSW 18 52520911 critical splice acceptor site probably null
R1794:Lox UTSW 18 52528307 missense probably damaging 1.00
R3122:Lox UTSW 18 52525105 missense probably damaging 0.97
R5436:Lox UTSW 18 52529103 missense probably benign
R5679:Lox UTSW 18 52528917 missense probably benign 0.00
R6739:Lox UTSW 18 52526959 missense possibly damaging 0.95
R7679:Lox UTSW 18 52525106 missense possibly damaging 0.80
R7840:Lox UTSW 18 52525122 nonsense probably null
R7923:Lox UTSW 18 52525122 nonsense probably null
R8015:Lox UTSW 18 52528348 missense probably benign 0.27
Z1176:Lox UTSW 18 52520834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGAAACCAGCTTGGAACCAGTG -3'
(R):5'- CAGAACGGCTTGTGTAACTGCAAAC -3'

Sequencing Primer
(F):5'- TTGGAACCAGTGGCGGG -3'
(R):5'- CTTGTGTAACTGCAAACTGGTC -3'
Posted On2013-04-24